ࡱ>   y z { | } ~   -bjbj}} 1``#h PP4h< $:V$"x$x$x$H0H0H0$S*1/|H011*PPx$x$T ?e9e9e91P8x$x$e91e9e9b$hx$w2BVU0j;4hhH0L06e90,0H0H0H0**6H0H0H01111H0H0H0H0H0H0H0H0H0 :  POLICY NAME: DISCHARGE POLICYPOLICY REFERENCE:TW10-043VERSION NUMBER :8APPROVING COMMITTEE:Medicine Governance and Risk DATE THIS VERSION APPROVED: February 2019 RATIFYING COMMITTEE: PARC (Policy Approval and Ratification Committee) DATE THIS VERSION RATIFIED:February 2020AUTHOR(S) (JOB TITLE)HEAD OF NURSING - MEDICINEDIVISION/DIRECTORATE:MEDICINELinks to other Strategies, Policies, SOPs, etc.TW10-043 SOP 1 Discharge ProcedureCONSULTED WITHDQEC Members Date(s) previous version(s) approved: (if known)Version: 7 Date: July 2015 DATE OF NEXT REVIEW:February 2022Manager responsible for review: N.B. This should be the Authors line managerDirector of Nursing  INCLUDEPICTURE "cid:image001.png@01D348C1.6CCFC4C0" \* MERGEFORMAT  CONTENTSPAGE NO. 1POLICY STATEMENT 22KEY PRINCIPLES 23Criteria for discharging patients after 20:00 hours 34RESPONSIBILITIES 45Patients who take their own discharge/ Leave/ Refuse Admission 9 6DISCHARGE LOUNGE10 7HUMAN RIGHTS ACT 108INCLUSION & DIVERSITY 109MONITORING AND REVIEW 1010ACCESSIBILITY STATEMENT 10 APPENDICES1Definitions112Legislation133Nursing Documentation144Criteria for discharging patients after 20:00 hours175Contact Assessment Form (CAF)186CAF Discharge Notification to Social Services (Section 2)207Discharge Notification to Social Services (Section 5)218EPR Discharge Letter229Equality Impact Assessment Form2410Monitoring & Review template 25  1. POLICY STATEMENT 1.1 Wrightington, Wigan and Leigh NHS Foundation Trust acknowledge that appropriate and timely discharge planning is fundamental to the provision of effective health care. 1.2 The Trust endeavours to ensure that all patients have a safe and effective discharge, taking into account the patients own individual needs and views, along with those of their carers. 1.3 It is anticipated that over the coming years that the established inter-agency working and collaboration will continue, and build on the foundation that discharge planning is a process and not a single event. 2. KEY PRINCIPLES 2.1 This Discharge Policy and Standard Operating Procedure (SOP) are intended to give a local guide for good discharge planning for the discharge of patients from Wrightington, Wigan & Leigh NHS Foundation Trust, taking into account national policies and guidelines, amalgamated with local practice, and to ensure that patients are discharged from hospital in a planned and timely manner to a safe and clinically appropriate environment. Nursing discharge documentation will assist in this. (Appendix 3). 2.2 To ensure that patients (and, with their permission) relatives and carers are informed and involved in the planning of their care and subsequent discharge. 2.3 Where a patient lacks capacity under the MCA to take part in discussions or make decisions regarding their discharge, there is a duty to consult with the patients family and those close to the patient, and/or patient advocate including an IMCA (Independent Mental capacity Advocate). 2.4 Where a patient who lacks capacity has no one close to them with whom health professionals can consult, and decisions are being made about discharge arrangements, a referral should be made to the local Independent Mental Capacity Advocacy service for an IMCA to be appointed for the patient. In such cases, the role of the IMCA is to check that the best interests principle has been followed and to ensure that the persons wishes and feelings have been appropriately considered and to seek a second opinion if necessary. This referral should be made by the decision maker, who, in the instance of discharge, will be the social worker. 2.5 To support the provision of a planned transfer of care ensuring that health and social care services are in place when the patient is discharged. Ensure that the contact assessment form is completed and sent to our social partners. (Appendix 5). 2.6 To support the provision of a continuity of care through effective communication between hospital and community professionals. 2.7 To support the provision of timely information/medication/equipment to enable independence for the patient and carer. 2.8 To reduce admissions to residential and nursing homes across the Borough of Wigan, Leigh and Ashton. 2.9 This policy and SOP applies to patients being discharged only. For patients transferred to other locations please refer to the patient transfer policy. 2.10 To ensure that the Greater Manchester Hospital Discharge (Prevention of Homelessness) protocol is available on Wrightington, Wigan and Leigh NHS Intranet and is adhered to on admission for those persons classed as No Fixed Abode. 2.11 To reduce delays in discharge and support optimal bed management, and safe patient flow. 2.12 To ensure timely access for elective and emergency admissions. 2.13 To ensure that discharge planning takes into consideration patients who have special needs, sight, hearing impairment, whose first language is not English, or who have learning difficulties are involved in the discharge plan and understand the agreed plan, before agreeing to it. 2.14 To ensure where appropriate that patients are screened for NHS continuing healthcare or fast tracked as appropriate. In the event that residential/nursing home placements are required, consider if the person requires assessment for Funded Nursing Care. (FNC) 2.15 If concerns are raised by health/social care professionals or patients relating to a discharge or transfer to other healthcare organisations, the Integrated Discharge Team Leads need to be made aware and will assess and escalate to senior management in the event discharge is problematic. 2.16 To ensure that for patients who wish to leave hospital against medical advice, every effort should be made to appeal to the patient and carer to stay if the patient is vulnerable clinically or socially. Regardless of the decision by the patient to self-discharge, a copy of the HIS discharge letter will be sent to the patients GP and all medication should still be offered to the patient. The patients next of kin will be notified to advise that the patient has taken self-discharge against medical advice. 3 Criteria for discharging patients after 20:00 hours 3.1 Patient consents and wishes to go home late at night. 3.2 Appropriate transportation available with agreement and consent of patients/carer/nursing home facility. 3.3 During inclement weather, confirmation of adequate heating in home and patient has adequate clothing, food supplies, packed sandwiches and sundries will be provided by the ward. 3.4 Confirmation that next of kin/carers will ensure the patients safety on discharge, including the provision of food and beverages. 3.5 Confirmation with relevant nursing/residential care facility that a named person will accept patient back to the care facility home after 20:00 hours. Patients must be offered a pre transfer beverage and meal/snack and all relevant medication will be administered prior to discharge. 3.6 Patient is adequately clothed to maintain privacy and dignity. 3.7 All the above will be documented in the patients nursing notes and will be counter signed by the nurse in charge of the shift. 3.8 Statement in the nursing documentation confirming that the patient has agreed to be discharged after 20:00 hours and that the care facility has also agreed. See Appendix 3.9 Frail Elderly patients, Patients with Dementia or Learning disability who lack capacity (Mental Capacity Act policy) will not be discharged after 20:00 hours. The exceptions to this will be: 3.9.1 End of life rapid discharge. 3.9.2 Carer/relative agrees and consents to the discharge after 20:00 hours whether the discharge is home or residential/nursing home. 3.9.3 The residential/nursing home agrees to discharge after 20:00 hours. 3.10 If the decision is taken to discharge this vulnerable group of patients after 20:00 hours, this must be clearly documented in the patients notes, discharge document and in the Discharge after 20:00 hours document. (Appendix 4) 4. RESPONSIBILITIES 4.1 Whilst it is recognised that the discharge process is a multi-disciplinary team process, it is also necessary to acknowledge that within any multi-disciplinary working there will be certain responsibilities assigned to particular staff members and/or staff groups. 4.2 Below are the key responsibilities covered within this policy to support implementation of the discharge procedure and any Specific roles and responsibilities relating to the various stages and types of discharge process are set out in greater detail within that procedure. 4.3 Trust Board The Trust Board will: 4.3.1 Receive reports, as appropriate, in relation to patient discharge letter, and compliance with the Discharge Letter processes. 4.3.2 Receive and make recommendations for further action in respect of issues relating to the discharge process which are raised or presented to the Board by the Director of Nursing and/or Medical Director. 4.3.3 Ensure principles in this policy are disseminated throughout the organisation via the usual channels. 4.4 Chief Executive responsibilities Ensuring that this policy and SOP is implemented within all areas of the Trust through responsible Executive Directors, Divisional Chairs and Divisional Director of Operations and Performance. Director of Nursing responsibilities The Director of Nursing is responsible, through their leadership, for the safety and quality function for: Supporting the Chief Executive and Trust Board in their responsibilities. Providing assurance that the discharge process is monitored, managed and reviewed in line with national guidance. Supporting the Divisional Chairs, Divisional Director of Operations and Performance and Head of Nursing in implementing this policy across the Trust. Support implementation and embed safe working practices in relation to Discharge Letters and the use of the process Together with the Medical Director, deliver assurance in relation to the safe operation and use of the Discharge Letter processes. Medical Director responsibilities Supporting the Chief executive and Trust Board in their responsibilities. Supporting the Divisional Chairs and Divisional Director of Operations and Performance in implementing this policy. Deliver assurance that clinicians are completing Discharge Letters for the patients, where appropriate, in a timely manner. Support divisional teams in implementing the principles of this policy. Together with the Director of Nursing, delivering assurance in relation to the safe operation and use of the Discharge Letter processes. Divisional Director of Operations and Performance and Head of Nursing responsibilities Ensure that the principles outlined within this policy and SOP are effectively implemented and embedded within their respective divisions. That they notify the Director of Nursing and/or Medical Director of any issue or problem, which does, or may impact, on the implementation and effectiveness of the discharge process. Matrons Responsibilities Ensuring that the principles outlined within this policy and SOP are implemented within their own areas of responsibility. Ensuring that the principles of effective discharge processes are maintained at ward level. Ensuring staff have access to training and competency of staff for nurse-led discharge. Ensure ward teams are safely and effectively using the Discharge Letter processes within HIS. Ward Managers/ Nurse in Charge Responsibilities Ensure discharge planning whiteboards are updated twice daily. Escalate complex discharge up to the Complex Discharge Team as appropriate. Co-ordinating a smooth discharge process. Maintenance of up to date, accurate discharge documentation and documentation of ongoing discharge planning and arrangements, required to meet the patients needs. Ensuring the involvement of, and communication between, all multi-disciplinary team members, agencies and the patient and/or carer(s). Ongoing review of Expected Date of Discharge. (EDD) Ensuring patients are screened for NHS continuing healthcare. Achieving and maintaining the skills and competencies to facilitate and lead on patient discharge. Ensuring adequate staff within the clinical area are trained to use CSC/HIS to facilitate real time discharge. Ensure safe and effective use of the nursing aspects of the Discharge Letter process within their wards/departments. Maintain HIS lists of previously discharged patients to provide assurance that all relevant patients Discharge Letters have been sent to their GP. Regularly review the above lists and resolve any issues with patients without a Letter Sent status, together with MDT. Escalate to medical colleagues those patients without a completed Discharge Letters. Resolve, together with ward team those patients requiring nursing interventions to the Discharge Letter process. Escalate any technical/IT issues with the Discharge Letter process to ensure issues are resolved in a timely manner. Nursing/Midwifery staff responsibilities Complete a section 2 notification if applicable on admission. (Appendix 6) Ensure that the contact assessment form is completed and sent to our social care partners. (Appendix 5) Complete a Section 5 (appendix 7) when all assessments are complete and delay is attributable to social services. Assess patients discharge needs within 24 hours of admission. Complete referrals to other agencies as required. Identify Adult at risk. (refer to MCA/DoLS Policy) Identify, document and communicate the patients discharge needs to the ward manager. Maintenance of up to date accurate discharge documentation and documentation of ongoing discharge planning and arrangements required to meet the patients need. Ensure the involvement of and communication between all multi-disciplinary team members, agencies and the patient and /or carer(s) Ensure that immediately a potential discharge problem is identified, that this is communicated so that referral to the appropriate member of the Multi-disciplinary team can be made at the earliest opportunity To ensure real time discharge of the patients by updating CSC/HIS at the point of discharge. Ensure patients are transferred to the Discharge Lounge in a timely manner adhering to the transfer policy. Ensure the discharge checklist is completed on discharge and a copy retained in the medical notes. Ensure a copy of the HIS discharge letter is sent to the GP within 24 hours of discharge (Appendix 8) To ensure patients discharge to nursing/residential/intermediate care and community beds have a discharge check list completed. To ensure continuity of infection control precautions are required to be carried out in relation to nursing and rest homes. Work together with MDT to identify patients for discharge to ensure timely creation of the Discharge Letter. Ensure adequate communication with patient/carer in relation to medication issues on discharge. Complete the Pharmacy Discharge Checklist document on HIS accurately and liaise with pharmacy to ensure timely processing of Discharge Letters and medication dispensing Use HIS functionality to monitor progress of Discharge Letter prescription in pharmacy and ensure timely collection of medication when complete, to ensure timely discharge and improved patient experience. Ensure medication and Discharge Letter are checked on ward, and that patient is counselled on relevant changes or follow-up required. Ensure letters are sent using the HIS system once completed, and patient is being discharged. Exercising particular care where letters are being processed after patient discharge to ensure these are correctly sent to the GP. Use the Bypass Pharmacy HIS order appropriately to ensure patients who do not need any medication have their letter processed correctly, and sent to their GP. Consultant responsibilities Agree a medical plan on admission and write this in the case notes. Review patients on a regular basis See Senior Review Policy. Ensure all investigations are completed, reviewed and documented as part of the patients medical plan based on an Expected Date of Discharge. Review the Expected Date of Discharge daily. Decide when the patient is medically fit for discharge and ensure that this is communicated to the medical team, the ward manager and the nurse in charge of co-ordinating the patient discharge process. Medical Staff responsibilities Patients are reviewed daily and that all investigations are completed, reviewed and documented as part of the patients medical plan based on an Expected Date of Discharge. Ensure the HIS discharge letter to GP is completed 24 hours before discharge where appropriate. NOTE Senior medical staff are also able to make a decision about whether the patient is medically fit for discharge. Pharmacy Senior Management 14.13.1 Ensure principles of this policy are effectively implemented and embedded within their department. 14.13..2 Escalate any technical/IT issues with the Discharge Letter process to ensure issues are resolved in a timely manner. Pharmacy Staff Ensure Discharge Letters presented to pharmacy are processed in a timely manner Work, on the wards, together with other MDT members, to identify patients for discharge, and to assist in resolving medication related issues prior to discharge Process, and enter, the relevant Pharmacy process orders within HIS to enable the patient list column in HIS to update correctly, and keep the wards informed regarding processing of the Discharge Letter prescription. Complex Discharge Team Lead Managing discharge arrangements for simple and complex discharges. Escalating discharge planning issues to their line manager as soon as delays are anticipated. Co-ordinating and leading the multi-disciplinary team when required for complex discharges. Working in partnership with all key professionals in the delivery of care for patients throughout their journey within the hospital setting, and transfer points to and from primary, intermediate and social care. Promote active discharge of non-complex patients as determined by the medical plan. Provide support and training for ward staff on all aspects of discharge planning. Attend daily whiteboard meetings with other members of the multi-disciplinary team when capacity does not meet demand. Attend grand rounds with other members of the multi-disciplinary team when capacity does not meet demand. Attend telephone conferences when the Trust is in escalation. Ensure fast Track NHS continuing Healthcare assessments are completed in a timely manner. Ensure that Home of Choice letters are issued in a timely manner for those patients assessed as requiring residential or nursing care homes where applicable Manage and co-ordinate the discharge of vulnerable adults. Discharge co-ordinators responsibility Co-ordinate all timely referrals. Work closely with the ward managers to ensure timely meetings are scheduled for multi-disciplinary meetings, Continuing Healthcare Screening and meetings, Capacity and Best interest meetings. Escalate any problems to the Complex Discharge Team Leads. Attend daily whiteboard meetings. Ensure patients and families are involved in their discharge plan. Co-ordinating multi-disciplinary teams for all patients who are positively screened into the NHS Continuing Healthcare process and collating all assessments and documentation for consideration by the Continuing Healthcare team. Identify patients who are suitable for Community step downs beds if applicable. Multi-Disciplinary Team Members The Trust, Bridgewater Foundation Trust and Social Services Department are committed to the continuation of a fully multi-disciplinary team model to manage the hospital discharge process. In addition to the consultant and supporting medical team who are responsible for the identification, planning and delivery of the patients medical plan, there are a number of Trust and non-Trust staff that offer or provide the link to accessing services and other care which is vital to safe and effective discharge collectively these are the multi-disciplinary team. Staff involved in planning for discharge are required to familiarise themselves of the services and care available for patients through the multi-disciplinary team as set out below: Note staff should access the discharge referrals guide for more information about what services are available and how to make a referral. Nominated Key Worker: A nominated key worker/named nurse will be designated for each patient in the hospital setting. The key worker will attend multi-disciplinary team meetings and maintain lines of communication with the patient in respect for their discharge. In addition a nominated associated nurse will undertake these tasks in their absence. District Nurses Services: A wide range of nursing services are provided within the home environment and within the treatment room sessions held at health centres and clinics across the Borough. There are district nursing teams based within the local clinics and health centres. However, between the hours 17:00-07:45, the district nursing team is based at Clare House. Referrals into the District nursing service should be made to the local district nursing team or via the district nurse liaison service. Refer to the hospital district nurse liaison service between the hours 08:00 and 16:30 hours, Monday to Friday. Social Worker: Early liaison with Social Services is essential for successful and timely discharge planning. The role of the Social Worker includes offering advice and support, counselling the patient and significant carers, advocating on their behalf and planning for the patients safe discharge from hospital. The social worker as an employee of the Local Authority, has a statutory responsibility to ensure patients receive appropriate community care services following an assessment of their needs and decision on eligibility for services. Both hospital and community based social workers work in partnership with multi-disciplinary teams to plan for discharge, enabling a patient to return to independence in their own home with supporting services if needed, or to alternative care in a residential or nursing home of their choice. Acts as lead professional with those clients identified as safeguarding. Triage Officer: The Triage Officer Triage-Support Officers are allocated cases for screening and monitoring purposes. In any instance where a person is deemed to require a full Social Care Assessment, the Triage Officers submit the case for re-allocation to a Social Worker. It has been part of the Triage-Support Officer role to liaise with the complex Discharge Team and to collect from Discharge Co-ordinators information concerning any cases of Delayed Transfers of Care. The officers then report this to Social Workers managing those cases. Occupational Therapist: The Occupational Therapy Service will be accessed in order to assist patients to achieve and maintain the highest level of personal functioning in all activities of daily living, and to minimise the need for re-admission to secondary care by ensuring initial discharge is safe and appropriate. On discharge, the Occupational Therapy staff will arrange longer-term intervention from the most appropriate Health and Social Services Team. Physiotherapist: The Physiotherapy Service will be accessed in order to provide early assessment and subsequent treatment and maintenance programmes that maintain the highest level of functional activity and independence. On discharge follow up will be arranged, if appropriate within the most appropriate setting. Pharmacist: Ward Pharmacists will assist the multi-disciplinary team at all times throughout the patient journey. Any patients who may have medication related problems on discharge should be referred to their ward pharmacist at the earliest opportunity. In addition to the ward pharmacist, pharmacists are available in the dispensary and may be contacted to advise on any acute problems with discharge prescriptions, including their need to be written in a way which satisfies legal and local requirements. Speech and Language Therapist: The speech and language therapy service will be accessed in order to provide early assessment and subsequent therapy or ongoing monitoring of communication and/or feeding difficulties which may have arisen as a result of surgery or acute medical episodes, or as part of a progressing condition. On discharge, follow up will be arranged, if appropriate, within the most appropriate format. Podiatrist: The Podiatry service will be accessed in order to ensure that podiatry problems are not compromising the safety and/or independence of patients in preparation for discharge and following discharge. Following treatment, patients are either discharged or referred to the appropriate service. Every effort will be made to see all patients referred. Access to Community Service Team (ACST): The Access to Community care team is an admission avoidance team who will provide early assessment and discharge in the Emergency Care Centre and assessment areas. On discharge follow up will be arranged as appropriate. Community Matrons: The Community Matrons will support early discharge for those patients on their existing caseloads. On discharge, follow up will be arranged if appropriate, within the most appropriate format. New patients identified as requiring assessment will be referred on discharge. Patients who take their own discharge/Leave/Refuse Admission Staff should refer to TW14-036 Self Discharge against Medical Advice and complete the documentation in accordance with this policy. A discharge summary letter (HIS) letter must be completed and sent to the patients GP and if possible, the patients copy should be given to the patient. If not discussed before the patients leaves, the patient/family should be contacted to discuss and provide action about medication. Pharmacy should be advised accordingly Discharge Lounge The Discharge Lounge is an area within the acute hospital where patients are transferred to when medically and clinically discharged awaiting final arrangements to be made i.e. transport and medication to take home. This allows wards to free up beds for acutely ill patients. 7 HUMAN RIGHTS ACT Implications of the Human Rights Act have been taken into account in the formulation of this policy and they have, where appropriate, been fully reflected in its wording. INCLUSION AND DIVERSITY The Policy has been assessed against the Equality Impact Assessment form from the Trusts Equality Impact Assessment Guidelines and, as far as we are aware, there is no impact on any personal characteristics. MONITORING AND REVIEW: This Policy and SOP will be subject to bi-annual review to ensure that they continue to meet changing patient and service needs, and will be subject to approval by the Divisional Quality Executive Committee. The three main clinical divisions: Medicine, Surgery and Specialist Services undertake annual audits around the discharge process which are presented and discussed at Divisional audit meetings, then put into report format for circulation with the meeting minutes. Actions are taken as appropriate within the Division. An annual clinical audit report is also presented to the Divisional Quality Executive Committees. ACCESSIBILITY STATEMENT This document can be made available in a range of alternative formats e.g. large print, Braille and audio cd. For more details, please contact the HR Department on 01942 77 (3766) or email  HYPERLINK "mailto:equalityanddiversity@wwl.nhs.uk" equalityanddiversity@wwl.nhs.uk APPENDIX 1 Definitions Acute Care Acute medical care is defined as intensive medical treatment provided by or under the supervision of a consultant which is for a limited time after which the patient no longer benefits from that treatment. Abuse Abuse is a violation of an individual's human and civil rights. It may consist of a single act or repeated acts. It can be physical, verbal or psychological; it may be an act or omission to act, Types of Abuse Physical: including hitting, shaking, biting, grabbing, withholding food or drink, force-feeding, wrongly administering medicine, unnecessary restraint, failing to provide physical care and aids to living Sexual: including sexual assault, rape, inappropriate touching/molesting, pressurising someone into sexual acts they don't understand or feel powerless to refuse Emotional or psychological: including verbal abuse, shouting, swearing, threatening abandonment or harm, isolating, taking away privacy or other rights, bullying/intimidation, blaming, controlling or humiliation Financial or material: including withholding money or possessions, theft of money or property, fraud, intentionally mismanaging finances, borrowing money and not repaying Neglect: including withholding food, drink, heating and clothing, failing to provide access to health, social and educational services, ignoring physical care needs, exposing a person to unacceptable risk, or failing to ensure adequate supervision Discriminatory abuse: including slurs, harassment and maltreatment due to a person's race, gender, disability, age, faith, culture or sexual orientation Consent This is a patients agreement for a health professional to provide care. Patients may indicate consent non-verbally, orally or in writing. For the consent to be valid, the patient must: Be competent to make the particular decision Have sufficient information to make the decision Not be acting under duress Complex discharge A complex discharge is: On admission it is identified that there have been significant changes in the care needs of a patient either on admission or as an inpatient. Unable to return to their normal place of residence Requires increased input from health and social care provider due to change in physical health Difficulty in finding an alternate place for discharge Those patients identified as safeguarding on admission Discharge Discharge is the process leading to the patient being discharged from the care of the hospital. Deprivation of liberty safeguard Provision under the Mental Capacity Act 2005 is to protect those individuals who for their own safety and in best interest needs to be accommodated to undergo treatment or care. This may deprive an individual of their liberties whilst they lack the capacity to contents (Refer to the MCA/DOLs Policy) Estimated Date of Discharge Estimated date of discharge is identified early as part of patients assessments and with 24 hours of admission (or in pre-admission for elective patients). It is based on the anticipated time needed for tests and interventions to be carried out and for the patients to be clinically stable and fit for discharge. Intermediate care Intermediate care services are those which meet all the following criteria: Are targeted at people who would otherwise face unnecessarily prolonged hospital stays or inappropriate admission to acute in-patient care, long-term residential care, or continuing NHS in-patient care. Are provided on the basis of a comprehensive assessment resulting in a structured individual care plan that involved active therapy, treatment or opportunity for recovery. Have a planned outcome of maximising independence and typically enabling patient/users to resume living a home. Is time limited, normally no longer than 6 weeks and frequently as little as 1-2 weeks or less and involve cross professional working with a single assessment framework, single professional records and shared protocols. Social care provided within Intermediate Care Services as in this definition are not chargeable. Intermediate Care Services should not include any transitional or holding service e.g. awaiting appropriate housing. Further work is required on pathways and services for people who are not able to return home but no longer fit the definition of Intermediate Care Ready for discharge or transfer The Department of Health states that a patient is ready for discharge or transfer from an acute hospital bed when: a clinical decision has been made that a patient is ready for transfer and a multi-disciplinary team decision has been made that the patient is ready for transfer and the patient is safe to discharge/transfer NHS Continuing Health Care: Is a package of Continuing care that is arranged and solely funded by the NHS whose primary need is Health. If someone is eligible then the NHS pays for all costs incurred for their care. If a patient is found to be eligible it may affect state benefits and allowances previously used to fund care. Simple Discharge A simple discharge is one that: Involve minimal disturbance to the patients activities of daily living Able to return to return to their normal place of residence Will not require a significant change in support to the patient or carer Have simple ongoing needs that do not require complex discharge planning and delivery Vulnerable Adult A person aged 18 or over who is or may be in need of community care services by reason of mental or other disability, age or illness, and who is or may be unable to take care of him or herself, or unable to protect him or herself, against significant harm or exploitation (Department of Health, 2000, 2.3). Transfer Transfer is the process whereby a patient transfers from one hospital ward or site to another Appendix 2 References and further information Legislation and guidance Discharge of patients Circular HC (89) 5 This outlined the responsibility of the NHS to prepare and implement a safe hospital discharge policy and to ensure that patients discharged from hospital are transferred to the care of a GP. Department of Health (2009) The National Framework for NHS Continuing Healthcare and NHS Funded Care This legislation requires Social Services to assess the needs of vulnerable adults and to provide services to meet assessed needs within available resources. Social Services Departments are required to respond to requests to meet assessed need and arrange services to support discharge from hospital. Fair Access to Care: Eligibility for Social Care Services 2003 Replaced by the Department of Health (2014) Care Act 2014 The New Act is built around giving a person greater choice and control in what care and support a persons needs. The Community Care (Delayed Discharges etc.) Act 2003 Replaced by the Department of Health (2014) Care Act 2014 The Act updates and re-enacts the provisions of the Community care (Delayed Discharges etc.) Act 2003 that relate to delayed discharges of NHS hospital patients from NHS acute care. The NHS is still required to notify relevant local authorities of a patients likely need for care and support and (where appropriate) carers support, where the patient is unlikely to be safely discharged from hospital without arrangement for such report being put into place first. (An assessment notice Section 2) Appendix 8. The NHS also has to give 24 hours notice of when it intends to discharge the patients (discharge notice Section 5) Appendix 9. From the 1st April 2015 if a local authority has not carried out an assessment or put in place care and support or (where applicable) cares support, and that is the sole reason for the patient not being safely discharged, the NHS body has a discretion as to whether to seek reimbursement from the relevant local authority for each day that an acute patients discharge ids delayed. Safeguarding If the patient is undergoing safeguarding investigation in respect of discharge destination, the discharge must not go ahead until communication has taken place with the lead investigating social worker or Head of Adult Safeguarding Appendix 3 Nursing Discharge Documentation Discharge Planning Form NAME/ID NO Proposed date of discharge: _____/____/_____Discharging area: Discharge to: Home(Intermediate care(Residential/Nursing Home(Date signature and PrintCommentsOn admissionTransport Patient has made own transport arrangements or Hospital Transport pre-booked (if medical need)EDD recorded on whiteboard Contact Assessment Form completed if applicableSection 2 sent to Social services, if requiredMultidisciplinary Team Medically discharge by speciality teamPhysiotherapist agreement if applicableOccupational Therapist agreement if applicableSocial Work agreement to discharge date Care package in place if applicableCommsPatient aware of discharge dateRelatives/Carers aware of discharge dateHeating on/food availableHouse Keys available/ Key safe Number available- Please ensure code given on a need to know basis 24 hours prior to DischargePatients own transport arrangements confirmed or Hospital Transport booking confirmedEPR discharge letter completed(To have 28 days for transitional beds)Take home medications dispensed and explained to patient/carerOutpatient appointment made, if required Date:- Who with:-Wound caresee next pageYes/NoDistrict nurse/dressings see next pageYes/NoSec 5 sent to Social services, if requiredYes/NoOn the day Patient transferred to Discharge Lounge? (Contact number of ward given)Yes/NoDischarge letter sent to GP/ Copy given to Patient/familyYes/NoHave you checked that the patients cannulae has been removed?Has the Family/Friends test been completedYes/No Discharge Planning Form NAME/ID NO Please complete the 2nd page if transferring to Nursing home/Residential home or transitional bed Comms for NH/RHSKIN INTEGRITY Was the patient admitted with a pressure sore? Grade of pressure sore on admission Medical illustration requested and tracked Grade of pressure sore on discharge Dressings supplied (3 days supply) and frequency of dressings Does the patient require a district nurse referral Date referred and faxedPlease Circle Yes/No Grade Yes/No Grade Yes/No Yes/No Date Comms for NH/RHNUTRITIONAL STATUS Nutritional Score on admission Nutritional Score on discharge Please state type of modified diet Consistency of Fluids Score Score Comms for NH/RHFALLS/MOBILITY Falls risk assessment score Has the patient had any falls whilst in hospital Is the patient a high risk of falls Does the patient require a walking aid Walking aid discharged with patient  Score Yes/No Yes/No Please state Yes/NoComms for NH/RHCONTINENCE Does the patient have a catheter passport? Does the patient require an emergency supply of continence pads? and supplied Yes/No Yes/No Comms for NH/RHMEDICATION Are there any changes to medication? Please list below any changes in medication on other Information Does the patient require a blister Pack ( Ensure EPR is completed 24hrs in advance of EDD) Yes/No Yes/NoComms for NH/RHBREATHING Does the patient require Oxygen Does the patient require Mask or Nasal Cannulae (Please state) Please state % of oxygen and No number of hours to be used Has Oxygen been ordered? Date for delivery of Oxygen  Yes/No Yes/No DateComms for NH/RHINFECTION CONTROL Has the patient any history of infection Was the patient on any antibiotics pre admission Has the patient any infection on discharge e.g CDT /MRSA Are there any precautions that need to be followed on discharge, please state Will the patient be discharged on antibiotics  Yes/No Yes/No Signature and Print name Date Discharge Planning Form NAME/ID NO Signature and Print name Date  OTHER INFORMATION Signature and Print name Date Appendix 4 Criteria for discharging patients after 20:00 hours DISCHARGING PATIENTS AFTER 20.00HRSPatient Name/ Address/Unit numberD.O.BDischarging WardHas Patient Given Consent to be Transferred After 20.00hrs ConsultantPatients Signature/Verbal confirmationTime confirmed of transport arrangements, ambulance, private, family transportDate & Time of dischargeRecord name of destination of patient being discharged to, home, care facilityIf home confirmation of adequate provisions of/Food/Heating and Patient carer if required.Relative/Carers Signature or verbal confirmation If Nursing or Residential Home please provide conformation of acceptance After 20.00hrs. Name of Acceptor Confirmation that the patient had a meal/snack/beverage/relevant medications before dischargeHas patient adequately dressed before dischargeDischarging Nurse Signature Appendix 5 Contact Assessment Form (CAF)   Appendix 6 CAF Discharge Notification to Social Services (Section 2)  Appendix 7 Discharge Notification to Social Services (Section 5)  Appendix 8 Discharge Letter DISCHARGE LETTER (Insert date)GP COPY DR IG OWEN PEMBERTON SURGERYPEMBERTON PCRCSHERWOOD DRIVEPEMBERTON,WIGANWN5 9QX Dear DoctorRE: xxxxxxx, xxxxxxDOB:xx/xx/xxxx NHS No:xxx xxx xxxx, PAS No:xxxxxx X xxxxx STREET,WIGAN,WNx xxx Admission Date/Time: xx/xx/xx xx:xx to(Insert) WARD Discharge Date/Time: xx/xx/2010xx:xx from(Insert), RAEI Discharging Consultant: DR Y S ANG Referred by: A and E Discharge Status: xxxxxxxxxxxxxxxxxxxx Patient's 18 Week Pathway Not applicable - Emergency Admission Primary Diagnosis i.e. main condition treated or investigated xxxxxxxxxxxxxxxxxxxx Operations and Diagnostic Procedures performed during Admission n/a Outcome of Operations and Diagnostic Procedures performed during Admission n/a Diagnosis on Discharge & Recommendations xxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxx Clinical History xxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxx Clinical Findings & Pertinent Investigations xxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxx Changes to Admission Medications xxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxx Adverse Reactions or Allergies to Medications or Treatment none DISCHARGE MEDICATION Dose Frequency (Instructions) No. of days supply Notes xxxxxxxxxxxxxxxxxx xxx xxxxxxx xx xxxxxxxxxxxxxx xx xxxxx xx Immediate Post Discharge Requirements none No Follow-up/Planned Investigations Infections (other than M.R.S.A or C.diff) none Yours sincerely, SHO  *CONTACT DETAILS FOR G.P. (details of the most relevant person to contact regarding the discharge).*Name:Insert*Position:Consultant*Contact Tel No:01942 822336*Address of Ward:Insert Ward, Royal Albert Edward Infirmary, Wigan Lane, Wigan, WN1 2NN APPENDIX 9 Equality Impact Assessment Form STAGE 1 - INITIAL ASSESSMENT For each of the protected characteristics listed answer the questions below using Y to indicate Yes and N to indicate No Protected Characteristics Reasons for negative/positive impactMale/FemaleAgeEthnicityLearning DisabilityHearing ImpairmentVisual ImpairmentPhysical DisabilityMental HealthGay/Lesbian/BisexualTransgenderReligion/BeliefMarriage/Civil PartnershipPregnancy & MaternityCarers Does the policy have the potential to affect individuals or communities differently in a negative way?NNNNNNNNNNNNNN Is there potential for the policy to promote equality of opportunity for all/promote good relations with different groups Have a positive impact on individuals and communities.YYYYYYYYYYYYYY In relation to each protected characteristic, are there any areas where you are unsure about the impact and more information is needed?NNNNNNNNNNNNNN If Yes, please state how you are going to gather this information. Job TitleDeputy Chief PharmacistDateJanuary 2019 IF YES an NEGATIVE IMPACT IS IDENTIFIED - A Full Equality Impact Assessment STAGE 2 Form must be completed. This can be accessed via  HYPERLINK "http://intranet/Departments/Equality_Diversity/Equality_Impact_Assessment_Guidance.asp" http://intranet/Departments/Equality_Diversity/Equality_Impact_Assessment_Guidance.asp Please note: As a member of Trust staff carrying out a review of an existing or proposal for a new service, policy or function you are required to complete an EIA. By stating that you have NOT identified a negative impact, you are agreeing that the organisation has NOT discriminated against any of the protected characteristics. Please ensure that you have the evidence to support this decision as the Trust will be liable for any breaches in Equality Legislation. Appendix 10 POLICY MONITORING AND REVIEW ARRANGEMENTS ParaAudit/Monitoring requirementMethod of Audit/MonitoringResponsible personFrequency of AuditMonitoring committeeType of EvidenceLocation where evidence is held  Divisional Matrons to complete annual audit with required action planData capture review of documentationDivisional Heads of NursingAnnualDQECAudit reportDivisional Governance 25     Discharge Policy Version No 8. Author(s) Head of Nursing Ratified PARC: February 2019 Next Review Date: February 2022 PAGE  PAGE 24 AT ALL TIMES, STAFF MUST TREAT PATIENTS WITH RESPECT AND UPHOLD THEIR RIGHT TO PRIVACY AND DIGNITY. #$%6789?@AQRSѿ|o|aO@h< 5CJOJQJ^JaJ#hFUhFU5CJOJQJ^JaJh @hFU5OJQJ^Jh @5CJOJQJ^Jh @h @5CJOJQJ^J#hFUhFU5CJ OJQJ^JaJ h @5CJOJQJ^JaJ#hFUhFU5CJOJQJ^JaJ#hFUhS5CJOJQJ^JaJh5OJQJ^Jh v5OJQJ^Jhe5OJQJ^Jjh0mQUmHnHu$H$&`#$/If^HgdFU$&`#$/IfgdFUgde $F]Fa$gdy7~$%7@WG3H$&`#$/If^HgdFU$&`#$/IfgdFUkd$$Ifl      W0`'  t 6`0VVVVVV'644 l` apytFU@ARTWG3H$&`#$/If^Hgd< $&`#$/IfgdFUkd$$Ifl      N0`'  t 6`0VVVVVV'644 l` apytFUSTUijt   ' ɷ۷ɷygXɷgIXɷha 5CJOJQJ^JaJhFU5CJOJQJ^JaJ#hFUhFU5CJOJQJ^JaJhp5CJOJQJ^JaJ hFUhFUCJOJQJ^JaJh Z5CJOJQJ^JaJhp5CJOJQJ^JaJ#hFUhFU5CJOJQJ^JaJ#hFUhS5CJOJQJ^JaJ#hFUhFU5CJ OJQJ^JaJ #hFUh< 5CJOJQJ^JaJTUjWG3H$&`#$/If^Hgd Z$&`#$/IfgdFUkd$$Ifl      .0`'  t 6`0VVVVVV'644 l` apytFUWGGG3H$&`#$/If^HgdFU$&`#$/IfgdFUkd$$Ifl      .0`'  t 6`0VVVVVV'644 l` apytFUWGG3H$&`#$/If^HgdFU$&`#$/IfgdFUkd$$Ifl      0`'  t 6`0VVVVVV'644 l` apytFU  * WGG3H$&`#$/If^HgdFU$&`#$/IfgdFUkdo$$Ifl      0`'  t 6`0VVVVVV'644 l` apytFU' ) * + 5 6 A B \ ] ^ s t | } ~ ̺ޭ̺ޑ}iWHhp5CJOJQJ^JaJ#hphp5CJOJQJ^JaJ&hphFU5;CJOJQJ^JaJ&hphp5;CJOJQJ^JaJh @5CJOJQJ^JaJhFUhFUOJQJ^JhFUhSOJQJ^J#hFUhS5CJOJQJ^JaJ#hFUhFU5CJ OJQJ^JaJ #hFUhFU5CJOJQJ^JaJh.5CJOJQJ^JaJ* + 6 B ] WGG3H$&`#$/If^HgdFU$&`#$/IfgdFUkdR$$Ifl      0`'  t 6`0VVVVVV'644 l` apytFU] ^ t } WG3H$&`#$/If^HgdFU$&`#$/IfgdFUkd5$$Ifl      ?0`'  t 6`0VVVVVV'644 l` apytFU} ~ WG3H$&`#$/If^HgdFU$&`#$/Ifgdpkd$$Ifl      ?0`'  t 6`0VVVVVV'644 l` apytFU WG3H$&`#$/If^HgdFU$&`#$/IfgdFUkd$$Ifl      C0`'  t 6`0VVVVVV'644 l` apytFU  " * , - . 0 ? @ B C X e f g ̽r``M=Mh Z5B*OJQJ^Jph$h-VDh?5B*OJQJ^Jph#h-VDh @5CJOJQJ^JaJh?5CJOJQJ^JaJh< 5CJOJQJ^JaJ#h-VDh?5CJOJQJ^JaJh-VDh?OJQJ^Jh-VDh?5OJQJ^JhO5CJOJQJ^JaJ#hFUhFU5CJ OJQJ^JaJ #hFUh @5CJOJQJ^JaJh5CJOJQJ^JaJ  " - WRII< 4$If]4gd< $IfgdOgd?kd$$Ifl      C0`'  t 6`0VVVVVV'644 l` apytFU- . / 0 @ A B 4$If]4gd-VD 4$If]4gd< $4$If]4a$gd-VDB C X f @7* 4$If]4gd-VD $IfgdOkd $$Ifl      7F`'8x  t0VVVVVV'6    44 l` apyt-VDf g ^UUH 4$If]4gd-VD $IfgdOkd $$Ifl      70`'8  t0VVVVVV'644 l` apyt-VDg o p           ) + , Ĺ񬡙wsaSaSB h]9Mh @CJOJQJ^JaJh-VDhNe5OJQJ^J#h-VDhNe5CJOJQJ^JaJhNehr5OJQJ^JhO5OJQJ^Jja h0mQUh0mQjh0mQUhe5OJQJ^Jh-VDhR <OJQJ^Jh @5OJQJ^Jh-VDhy7~OJQJ^J#h-VDhy7~6CJOJQJ^JaJh-VDh)-5OJQJ^Jh-VDhR <5OJQJ^J     ^YYYWKB $Ifgd&G $$Ifa$gd-VDgdekd $$Ifl      70`'8  t0VVVVVV'644 l` apyt-VD ) * + - ? @ B YPP $Ifgd&Gkd1$$IflFf &co t06    44 layt-VD $$Ifa$gd-VD $IfgdNe, = > @ A C D S T V W Y [ p ﻩ̻udVE h]9Mh_ CJOJQJ^JaJhCJOJQJ^JaJ h]9MhNeCJOJQJ^JaJ h]9MhZiCJOJQJ^JaJ h]9Mh]9MCJOJQJ^JaJ#h]9Mh]9M;CJOJQJ^JaJ#h]9Mh @;CJOJQJ^JaJ h]9Mh @CJOJQJ^JaJh]9MCJOJQJ^JaJ)h]9MhNeB*CJOJQJ^JaJph h]9MhABCJOJQJ^JaJB C E U V X nbYYb $Ifgd&G $$Ifa$gd-VDkdx2$$IflFf &co t06    44 layt-VDX Y [ nbYYb $IfgdNe $$Ifa$gd-VDkd3$$IflFf &co t06    44 layt-VD nbYHb$If^`gd-VD $IfgdNe $$Ifa$gd-VDkd3$$IflFf &co t06    44 layt-VD nbSGb> $IfgdC x $$Ifa$gde+ 9r $Ifgde+ $$Ifa$gd-VDkd:4$$IflFf &co t06    44 layt-VD         ! " # , 9 : < > ? U V W Y [ Ϳ͒́p͒ͿpͿ͒p^pp#h]9Mh_ 6CJOJQJ^JaJ h]9Mh_ CJOJQJ^JaJ h]9MhNeCJOJQJ^JaJh]9MCJOJQJ^JaJ h]9Mh]9MCJOJQJ^JaJhZiCJOJQJ^JaJhCJOJQJ^JaJ h]9MhZiCJOJQJ^JaJhe+;CJOJQJ^JaJ#he+he+;CJOJQJ^JaJ$    h\S\\ $IfgdNe $$Ifa$gd-VDkd4$$IflFf &co t06    44 lap yt-VD   h\SG\ $$Ifa$gd]9M $IfgdNe $$Ifa$gd-VDkds5$$IflFf &co t06    44 lap yt-VD ! # 9 : = h\SG; $$Ifa$gd-VD $$Ifa$gd]9M $Ifgd_ $$Ifa$gd]9Mkd6$$IflFf &co t06    44 lap yt-VD= > @ V W Z h\PD\ $$Ifa$gd]9M $$Ifa$gd-VD $$Ifa$gd-VDkd6$$IflFf &co t06    44 lap yt-VDZ [ ^ v w z h\SG\ $$Ifa$gd]9M $Ifgd $$Ifa$gd-VDkd\7$$IflFf &co t06    44 lap yt-VD[ ] w y {     # $ & ( ) * W c d f h s ´ӣӣӣӣƒh\CJOJQJ^JaJ#h\h\CJOJQJ\^JaJ h]9Mh]9MCJOJQJ^JaJhmvCJOJQJ^JaJ h]9MhCJOJQJ^JaJhCJOJQJ^JaJ h]9Mh]MCJOJQJ^JaJh]9MCJOJQJ^JaJ3z { | hfZQZ $Ifgd $$Ifa$gd-VDkd7$$IflFf &co t06    44 lap yt-VD j^U^ $Ifgd $$Ifa$gd-VDkd8$$IflFf &co t06    44 lap yt-VD j^U^ $Ifgd $$Ifa$gd-VDkd@9$$IflFf &co t06    44 lap yt-VD j^U^ $Ifgd @ $$Ifa$gd-VDkd9$$IflFf &co t06    44 lap yt-VD  j^U^ $Ifgd @ $$Ifa$gd-VDkd|:$$IflFf &co t06    44 lap yt-VD   $ ' j^U^ $Ifgd @ $$Ifa$gd-VDkd;$$IflFf &co t06    44 lap yt-VD' ( * d g j^U^ $Ifgd @ $$Ifa$gd-VDkd;$$IflFf &co t06    44 lap yt-VDg h j j^U^ $Ifgd @ $$Ifa$gd-VDkdV<$$IflFf &co t06    44 lap yt-VD j^U^ $Ifgd @ $$Ifa$gd-VDkd<$$IflFf &co t06    44 lap yt-VD    ᠱ~sh]R]h5OJQJ^Jh]9M5OJQJ^Jh0mQ5OJQJ^Jh @5OJQJ^J h]9Mh @CJOJQJ^JaJ h]9MhekCJOJQJ^JaJ h]9MhdIXCJOJQJ^JaJ h]9MhNeCJOJQJ^JaJ h]9Mh]9MCJOJQJ^JaJh\CJOJQJ^JaJ h]9MhCJOJQJ^JaJhCJOJQJ^JaJ j^U^ $Ifgd @ $$Ifa$gd-VDkd=$$IflFf &co t06    44 lap yt-VD  j^U^ $Ifgd @ $$Ifa$gd-VDkd0>$$IflFf &co t06    44 lap yt-VD    jeeeeeeeeeegd&Gkd>$$IflFf &co t06    44 lap yt-VD 3tu%&;d^`;gd4;d^`;gd1 ;^`;gd4gd4 ";]"^`;gd4 ;^`;gd7gd&G 012347justuvxyɾɳԡɓwfUɳɓ h7hXDCJOJQJ^JaJ h-VhekCJOJQJ^JaJhmvCJOJQJ^JaJh7CJOJQJ^JaJhekCJOJQJ^JaJ#hNehNe5CJOJQJ^JaJh75OJQJ^Jhek5OJQJ^JhXD5OJQJ^JhNe5OJQJ^Jh]9M5OJQJ^J)jh5OJQJU^JmHnHu>I*WvEFGHLd0OȺ䛍n]OhCJOJQJ^JaJ hR2hC CJOJQJ^JaJ hR2h$CJOJQJ^JaJhR2CJOJQJ^JaJh$CJOJQJ^JaJ hR2hR2CJOJQJ^JaJhtd&CJOJQJ^JaJh ZCJOJQJ^JaJh= CJOJQJ^JaJhC CJOJQJ^JaJhekCJOJQJ^JaJhpCJOJQJ^JaJ&GHHI-. ;^`;gd4 ;d]^`;gd4;d^`;gd$;d^`;gd4;d^`;gd;d^`;gdR226>^FGIL|+,-.1򴦴򦊦|kZ| h-Vh7CJOJQJ^JaJ h$hekCJOJQJ^JaJh~CJOJQJ^JaJh\CJOJQJ^JaJhECJOJQJ^JaJh$CJOJQJ^JaJh= CJOJQJ^JaJ h@WhCJOJQJ^JaJ h@WhekCJOJQJ^JaJhCJOJQJ^JaJhekCJOJQJ^JaJ /023<koZ[\]ap京|ֺn`ֺKֺ)hhqB*CJOJQJ^JaJphh~CJOJQJ^JaJh$CJOJQJ^JaJ h@WhCJOJQJ^JaJ h@Wh@WCJOJQJ^JaJh@WCJOJQJ^JaJhCJOJQJ^JaJhqCJOJQJ^JaJh7OCJOJQJ^JaJhCJOJQJ^JaJhekCJOJQJ^JaJhXDCJOJQJ^JaJ\]{| "!#!!!G"H"""##4$5$ ;^`;gdek ;^`;gdC ;^`;gd4p}adz{|0}~(28;A{~Ŵ|||n|||hCJOJQJ^JaJh$CJOJQJ^JaJhCJOJQJ^JaJh~CJOJQJ^JaJhCJOJQJ^JaJ h@WhqCJOJQJ^JaJ h@WhCJOJQJ^JaJh@WCJOJQJ^JaJhC CJOJQJ^JaJh CJOJQJ^JaJ+6 7 : D E !!!3!!!!(")"""##ȺȺ֪֘xjxj\jxjK h@Wh{Q,CJOJQJ^JaJhCJOJQJ^JaJh{Q,CJOJQJ^JaJh~CJOJQJ^JaJ"h\h\5;OJQJ^JaJ"h\h 5;OJQJ^JaJhh 5OJQJ^JaJh$CJOJQJ^JaJh@FCJOJQJ^JaJh CJOJQJ^JaJhC CJOJQJ^JaJhCJOJQJ^JaJ####2$3$$$X%Y%Z%g%h%i%%%%%%%-&.&O&P&f&l&q&x&y&&&&&''''''( ((䗆xjxxhC CJOJQJ^JaJh\CJOJQJ^JaJ h@WhCJOJQJ^JaJ h@Wh{Q,CJOJQJ^JaJhmvCJOJQJ^JaJhUCJOJQJ^JaJ#hB*CJOJQJ^JaJphh~CJOJQJ^JaJh{Q,CJOJQJ^JaJh@WCJOJQJ^JaJ)5$$$h%i% &-&.&Q&&"'#'(($(1)2)H*I*$;^`;a$gdk ;^`;gd$;^`;a$gd7 ;^`;gdk ^`gd0mQS`Sgd0mQ ;^`;gdek((($('(((((/)0)1)2)6))))))H*I*οykZIZ8 hD3.hD3.CJOJQJ^JaJ h@Wh CJOJQJ^JaJ h@WhD3.CJOJQJ^JaJhCJOJQJ^JaJhC CJOJQJ^JaJhCJOJQJ^JaJh~CJOJQJ^JaJh\CJOJQJ^JaJhD3.CJOJQJ^JaJh5CJOJQJ^JaJ hhCJOJQJ^JaJhh75OJQJ^JaJhh5OJQJ^JaJI*K*L*M*N*Z*o*p*s*t*u*v****+++.,/,0,2,3,ҵyoeXeG hhD3.CJOJQJ^JaJhcihciOJQJ^JhciOJQJ^JhCFOJQJ^JhCFhCFOJQJ^JhD3.OJQJ^Jh_=OJQJ^JhOJQJ^J hD3.hD3.CJOJQJ^JaJhD3.CJOJQJ^JaJh75CJOJQJ^JaJh5CJOJQJ^JaJhCJOJQJ^JaJ hhCJOJQJ^JaJI*Z*p**+0,U,--<---c.mm$ & F 9r ;^`;a$gd$ 9r ^a$gd4S$ & F 9r ;^`;a$gd $^a$gd\^gd Z$ 9r ;^`;a$gdD3. ';^`;gd $^a$gd$;^`;a$gd7 3,U,,----<----a.b..///p_pN@2h0mQCJOJQJ^JaJhciCJOJQJ^JaJ hcihciCJOJQJ^JaJ hcih~CJOJQJ^JaJ hcih4SCJOJQJ^JaJh4SCJOJQJ^JaJ#h4Sh4S5CJOJQJ^JaJ h\h\CJOJQJ^JaJhD3.CJOJQJ^JaJh~CJOJQJ^JaJh\CJOJQJ^JaJ h\hD3.CJOJQJ^JaJ#h4ShD3.5CJOJQJ^JaJc..m///////0a00Q11"2#2$ 9r ^a$gd4S$ & F 9r ;^`;a$gd$ & F 9r ;^`;a$gd$ 9r ;^`;a$gdD3.$ 9r ^a$gdci & F 9r ;^`;gd Z//00!0A0_0`00"2#2K2L2Y2z22333x3y333˺yj[ݺMMyhciCJOJQJ^JaJh Z5CJOJQJ^JaJh\5CJOJQJ^JaJh4SCJOJQJ^JaJ hcihciCJOJQJ^JaJ hcih~CJOJQJ^JaJ hcihUCJOJQJ^JaJ hcih4SCJOJQJ^JaJ#h::h75CJOJQJ^JaJ#h::h4S5CJOJQJ^JaJ h-Vh4SCJOJQJ^JaJ#2z23333Q445c5d555 6J66u777J8$ & F 9r ;^`;a$gd $ 9r a$gdci  9r gd Z & F 9r ;^`;gd Z & F 9r ;^`;gd Z33O4P4Q4444555c5d5q5555555566 6òòÐo^M<^M< h5HhciCJOJQJ^JaJ h5Hh~CJOJQJ^JaJ h5Hh&cCJOJQJ^JaJ#hkh&c5CJOJQJ^JaJh5H5CJOJQJ^JaJ hcihciCJOJQJ^JaJ hcih~CJOJQJ^JaJ hcih::CJOJQJ^JaJhciCJOJQJ^JaJh~CJOJQJ^JaJh::CJOJQJ^JaJ#hkh::5CJOJQJ^JaJ 6H6I6J666666.7M7N7O7s7t7u7|77777777H8I8J8888888,9-999999::::͚xjxjxjxjxh5HCJOJQJ^JaJ h5Hh5HCJOJQJ^JaJ h5HhnCJOJQJ^JaJ h5HhmvCJOJQJ^JaJ h5Hh\CJOJQJ^JaJ h5HhC CJOJQJ^JaJ h5HhciCJOJQJ^JaJ h5Hh~CJOJQJ^JaJ h5Hh&cCJOJQJ^JaJ)J88.99;::;v;w;;;U<<=7=j==_>>?@ & F 9r ^`gd Z & F 9r ;^`;gd Z  9r ^gd Z & F 9r ;^`;gd Z:::;;;t;u;v;w;;;;;;;;;T<U<j<v<ųŖziXG h5Hh\CJOJQJ^JaJ h5HhnCJOJQJ^JaJ h5Hh= CJOJQJ^JaJh\CJOJQJ^JaJh= CJOJQJ^JaJh~CJOJQJ^JaJh 5CJOJQJ^JaJ#hkhn5CJOJQJ^JaJhnCJOJQJ^JaJhCJOJQJ^JaJ h5Hh5HCJOJQJ^JaJh5HCJOJQJ^JaJv<w<<<<<<===5=6=7=@=M=N=i=j====^>_>>>????@@z@{@|@@@@@7ADAEAGAHAAAAͿͿͿޮ޿Ϳ޿޿޿ޝ޿Ϳ͌{͌ h5Hh4CJOJQJ^JaJ h5Hh5HCJOJQJ^JaJ h5HhC CJOJQJ^JaJ h5HhR2CJOJQJ^JaJh5HCJOJQJ^JaJ h5Hh~CJOJQJ^JaJ h5HhnCJOJQJ^JaJ h5HhmvCJOJQJ^JaJ-@|@@EAAABBCCD EjEEFFFFF$ & F 9r ;^`;a$gd$ & F 9r ;^`;a$gd$ 9r ^a$gdn$ 9r ^`a$gd Z & F 9r ^`gd ZAAAAA?BFFFFFFFG+G,G-G}GNraP?ra h5Hh~CJOJQJ^JaJ h5HhCJOJQJ^JaJ h5HhnCJOJQJ^JaJh5HCJOJQJ^JaJhCJOJQJ^JaJ#hhn5CJOJQJ^JaJh0mQCJOJQJ^JaJhnCJOJQJ^JaJ h5Hh5HCJOJQJ^JaJ h5Hh CJOJQJ^JaJ h5Hh@WCJOJQJ^JaJ h5HhAjCJOJQJ^JaJF-GGGHHHIITJUJpJJYKxx'd^`gd$ & F 9r a$gd$ 9r ^a$gd*$ & F 9r ;^`;a$gd$ 9r ^a$gd~ & F 9r ;^`;gd$ & F 9r ;^`;a$gd }GGGGGGGHHHHHH@III}I~IIIIIIRJSJTJUJ_JeJfJoJpJ°ޡޡ~o_R_R_h Z5OJQJ^JaJhh*5OJQJ^JaJh*5CJOJQJ^JaJ#h*h5CJOJQJ^JaJ h5HhC CJOJQJ^JaJh5H5CJOJQJ^JaJ#hh5CJOJQJ^JaJh~CJOJQJ^JaJh5HCJOJQJ^JaJ h5Hh~CJOJQJ^JaJ h5HhCJOJQJ^JaJpJvJwJxJJJJJJJJJJXKYKZKiK4M5M6MRMMMMMMMMNNNON!O"O#OuOvOwOOOO?P@P鷪vhvhvhvhvhvhhhjCJOJQJ^JaJ hjh~CJOJQJ^JaJ hjhCJOJQJ^JaJ#h;3h5CJOJQJ^JaJh*hOJQJ^JhOJQJ^Jh*5CJOJQJ^JaJh5OJQJ^Jh*OJQJ^Jhh*h*OJQJ^JhOJQJ^J(YKZKiKKZL5M6MRMMMON#OwOO@P}}}}}}} & F 9r ^`gd$ & F 9r ;^`;a$gd Z' d^`gd' & F d^`gd$ & F 9r a$gd';d^`;gd@PPPPPPP@QAQBQQQRRRRBRIRJRKRbRcRdR"S#S$S]S^S_SSSSSSSTTTTTTU°¢”ЃЃЃЃЃЃރq#h;3h;35CJOJQJ^JaJ hjh;3CJOJQJ^JaJh~CJOJQJ^JaJh\CJOJQJ^JaJ#hkh;35CJOJQJ^JaJh;3CJOJQJ^JaJhjCJOJQJ^JaJ hjh~CJOJQJ^JaJ hjhCJOJQJ^JaJ)@PPPBQQRRBRdR$S_SSSTTzzzzzzz$ & F 9r  ^` a$gd$ & F 9r a$gd$ 9r ^`a$gd;3 & F 9r  ^` gd & F 9r  ^` gd & F 9r ^`gdTTUUIWWXYW\_bcegh%j+kOlPl$ 9r ^a$gdx & F 9r  ^` gd$ & F 9r ;^`;a$gd$ 9r ^a$gd;3UUUXVaVVVHWIWWWWWXXXYYYZU\V\W\d\j]s]]]___bb'bcccccFdhdeeӟӎ|kkk|k|k|kkk hjh CJOJQJ^JaJ#hjh 5CJOJQJ^JaJ hjh0wCJOJQJ^JaJ hjh~CJOJQJ^JaJ#hjh\95CJOJQJ^JaJ hjhmvCJOJQJ^JaJ hjh\9CJOJQJ^JaJhjCJOJQJ^JaJh\9CJOJQJ^JaJ*ee!e$e%e&e*e+efgg4ggghhhhhhhhYiò~m~m~~\G~)h h0wB*CJOJQJ^JaJph h h0wCJOJQJ^JaJ h hmvCJOJQJ^JaJ h hkCJOJQJ^JaJ#h hk5CJOJQJ^JaJ h hjCJOJQJ^JaJ h hHGqCJOJQJ^JaJ hjhHGqCJOJQJ^JaJ hHGqhHGq#hjhHGq5CJOJQJ^JaJ#hjhUC5CJOJQJ^JaJYi[i$j%jMjj*k+k=kOlPllllmmm1mmmmmmmn2nͻު͘seWFeWss h hC CJOJQJ^JaJh0mQCJOJQJ^JaJh CJOJQJ^JaJ h hmvCJOJQJ^JaJ&h hx5;CJOJQJ^JaJ#h hx5CJOJQJ^JaJ h hxCJOJQJ^JaJ#h hk5CJOJQJ^JaJ h hjCJOJQJ^JaJ h hkCJOJQJ^JaJ h hw%CJOJQJ^JaJPllmmmmZn[nlnoooHprr$ ;^`;a$gd$ 9r ^a$gdUC$ & F# 9r ;^`;a$gd$ 9r ;^`;a$gdx 9r ;^`;gd & F# 9r ;^`;gd$ & F# 9r a$gd 2nYn[nlnnnooooooooooHp޻ުޙ|l\M?. h h_=CJOJQJ^JaJhCJOJQJ^JaJhh7OJQJ^JaJhh_=5OJQJ^JaJhh0mQ5OJQJ^JaJhh 5OJQJ^JaJh Z5OJQJ^JaJ h hUCCJOJQJ^JaJ h hmvCJOJQJ^JaJ h hw%CJOJQJ^JaJ"hhx5;OJQJ^JaJ h hxCJOJQJ^JaJ h hHGqCJOJQJ^JaJHpIpap2q3qJqrrsssFtGtttt$a$gd&Ggd_= & F(;^`;gd Z ;^`;gd 9r ;^`;gd Z & F( 9r ;^`;gd Z^gd Z & F'0`0gd Z ;`;gdHpIpap2q3qJqrrrrsssssóq]K>0hCJOJQJ^JaJh5OJQJ^JaJ#h h_=5CJOJQJ^JaJ&h0mQB*CJOJQJ\^JaJph&h B*CJOJQJ\^JaJph,h h~B*CJOJQJ\^JaJph,h hxB*CJOJQJ\^JaJphhh_=5OJQJ^JaJ h h ZCJOJQJ^JaJh ZCJOJQJ^JaJh Zh Z5OJQJ^JaJhR2CJOJQJ^JaJs(tCtGtHtttttttttttt u uuuﻪyj[L:#h^rh&G5CJOJQJ^JaJh]M5CJOJQJ^JaJhXD5CJOJQJ^JaJh5CJOJQJ^JaJh5CJOJQJ^JaJh_=5CJOJQJ^JaJ$h ht0JCJOJQJ^JaJ h htCJOJQJ^JaJ)jh htCJOJQJU^JaJhCJOJQJ^JaJ h hhCJOJQJ^JaJ h h_=CJOJQJ^JaJttttttttttttttttuuuuuuuuu u uu!ugd]9M$a$gd&Guu u!u"u-uuuvvvvvvww#w(wwwFxaxy0y;yFyyyyyzzW{`{d{e{||||M~|i||iii|i|i|$h{>h0J"CJOJQJ^JaJ h{>hmvCJOJQJ^JaJ h{>hCJOJQJ^JaJ#h{>h5CJOJQJ^JaJ h]9MhCJOJQJ^JaJhCJOJQJ^JaJ#h]9Mh5CJOJQJ^JaJh5CJOJQJ^JaJh&G5CJOJQJ^JaJ(!u"u-uuuvvvvwFxyyzV{W{`{|G|x||||| h@&^hgd]9M & F@&gdDw & F-DM gdDw@&gd]9Mgd]9M|L}}}~M~N~X~~~~ 'abt8 & F0`0gdDwgd]9M & F @&gdDw@&gd]9M & F@&gdDwM~N~X~~~V[ 'btVr89оааПЍ|m|_J)h)FhB*CJOJQJ^JaJphh{>hCJOJQJ\h]9M5CJOJQJ^JaJ h{>hCJOJQJ^JaJ#h{>h5CJOJQJ^JaJ h)FhCJOJQJ^JaJhmvCJOJQJ^JaJ#hh5CJOJQJ^JaJhCJOJQJ^JaJh5CJOJQJ^JaJ#hB*CJOJQJ^JaJphφ+UVrψR89B #dgd]9M & FgdDw 7$8$H$gd]9M & FgdDwgd]9M@&gd]9M9Bϋ֌;? 4;hijVXǏȏɏʏvggXh5CJOJQJ^JaJhG5CJOJQJ^JaJhmvCJOJQJ^JaJhGCJOJQJ^JaJ hhCJOJQJ^JaJhmv5CJOJQJ^JaJh\Ch5OJQJ^Jh5OJQJ^J,h3h5B*CJOJQJ^JaJphhCJOJQJ^JaJh5CJOJQJ^JaJϋЋՌ֌;ijWXɏʏKLɓʓד”ÔĔgd&Ggd@&gd$a$gd]9Mʏ!%VXŒltu}ɓʓדÔĔƔΔؔųpbSB h5CJOJQJ\^JaJhdIX5CJOJQJ^JaJh&GCJOJQJ^JaJ#h^rh5CJOJQJ^JaJh5CJOJQJ^JaJ hmhCJOJQJ^JaJ h{>hCJOJQJ^JaJ#h{>h5CJOJQJ^JaJh?hOJQJ^J#hhCJH*OJQJ^JaJhmvCJOJQJ^JaJhCJOJQJ^JaJĔŔƔǔȔɔʔ˔͔̔Δٔ $$Ifa$gdDwL`Lgd $L`La$gd$a$gd&Ggd&Gؔٔ !<=BCGHN`abcrvdz|t|l|l|t|dUD h84hCJOJQJ^JaJh84hCJ^JmH sH hCJaJhCJ^JhCJ^Jh84hCJ^Jh&hh5CJ OJQJ\^JaJ&hDwh5CJOJQJ\^JaJ&hDwh5CJOJQJ\^JaJ&hDwh5CJOJQJ\^JaJ&hh5CJOJQJ\^JaJ hdIX5CJOJQJ\^JaJ $Ifgdpkdl?$$Ifl&l(( t0(644 lap ytDw !=N`ar\\FF%xx$& #$/Ifb$gdDw%x$& #$/Ifb$gdDw$$& #$/Ifa$b$gdDwL`Lgdnkd?$$Ifll(( t0(644 lap ytDwabcc=&qq(($& #$(d/IfR]q^qb$gdDwkdt@$$Ifl4F %=(ly t 6 0(6    44 lae4f4ytDwcrx(($& #$(d/IfRb$gdDw"%$& #$(d/5$7$8$9DH$IfRb$gdDwvwxʕ˕וؕBCDE`acdeǖȖʖ˖Ƹ֤Ƙy։rgyrgyryrh84hCJ^J h84hh84h>*CJ^JmH sH h84hCJ^JmH sH h84h5CJ^J&h84h5CJOJQJ\^JaJhCJOJQJ^JaJhh84h5CJaJ h84hCJOJQJ^JaJh84hCJaJ joh84hCJaJ"=&qq(($& #$(d/IfR]q^qb$gdDwkdA$$Ifl4r  =(,y  S t 6 0(644 lae4f4ytDwʕ˕2kdA$$Ifl4\ =(,y t 6 0(644 lae4f4ytDw(($& #$(d/IfRb$gdDw˕ؕABCx"%$& #$(d/5$7$8$9DH$IfRb$gdDw(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDw-%$qq$& #$(d/5$7$8$9DH$IfR]q^qa$b$gdDwCDE@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkdB$$Ifl4\ =(ly  t 6  0(644 lae4f4p ytDwEabc(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDwcde@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkdC$$Ifl4\\ =( y  t 6  0(644 lae4f4p ytDwe(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDw@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkd|D$$Ifl4g\ =( y  t 6  0(644 lae4f4p ytDwȖɖʖ(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDwʖ˖@%$$& #$(d-D/IfM Ra$b$gdDwkd[E$$Ifl4\ =( y  t 6  0(644 lae4f4p ytDw˖ 5689:hiklmƗǗ"#2456gνޫνޫνޫνޫνޫޫޫޫh84hB*CJ^JphhCJ^Jh84h5CJ^Jh84hCJ^J h84h h84hCJOJQJ^JaJh84h>*CJ^JmH sH h84hCJ^JmH sH #h84h5CJOJQJ^JaJ. (($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDw @"%$& #$(d/5$7$8$9DH$IfRb$gdDwkd:F$$Ifl4\ =(ly  t 6  0(644 lae4f4p ytDw678(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDw89:@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkdG$$Ifl4a\ =( y  t 6  0(644 lae4f4p ytDw:ijk(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDwklm@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkdG$$Ifl4]\ =( y  t 6  0(644 lae4f4p ytDwm(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDw@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkdH$$Ifl4f\ =( y  t 6  0(644 lae4f4p ytDw(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDwǗ@-%$qq$& #$(d/5$7$8$9DH$IfR]q^qa$b$gdDwkdI$$Ifl4t\ =( y  t 6  0(644 lae4f4p ytDwǗ(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDw@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkdJ$$Ifl4\ =(ly  t 6  ̙0(644 lae4f4p ̙ytDw(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDw@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkdK$$Ifl4Z\ =( y  t 6  ̙0(644 lae4f4p ̙ytDw234(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdHGq456@"%$& #$(d/5$7$8$9DH$IfRb$gdDwkd_L$$Ifl4e\ =( y  t 6  ̙0(644 lae4f4p ̙ytDw6(($& #$(d/IfRb$gdDw%$& #$/5$7$8$9DH$Ifb$gdDw@7L`Lgdkd>M$$Ifl4\ =( y  t 6  ̙0(644 lae4f4p ̙ytDw1XY[\]rHLMPQRX|}ښޚߚƵƟѵƵƵƵƵƵƵ"h84h)5CJ\^JmH sH hCJOJQJ^JaJh84h)B*CJ^Jph h84h) h84h)CJOJQJ^JaJh84h)CJ^Jh84h)CJ^JmH sH h84h)5CJ^J&hh5CJOJQJ\^JaJ2(($(dIfRgdDw%$5$7$8$9DH$IfgdDw%$qq$(dIfR]q^qa$gdDwI,%$qq$(dIfR]q^qa$gdDwkdN$$Ifl4X\ =(ly  t ̙0(644 laf4p ̙ytDwYZ[(($(dIfRgdDw%$5$7$8$9DH$IfgdDw[\]I,%$qq$(dIfR]q^qa$gdDwkdN$$Ifl4\ =(,y  t ̙0(644 laf4p ̙ytDw](($(dIfRgdDw%$5$7$8$9DH$IfgdDwI$$%$qq$(d5$7$8$9DH$IfR]q^qa$gdDwkdO$$Ifl4\ =(,y  t ̙0(644 laf4p ̙ytDwə(($(dIfRgdDw%$5$7$8$9DH$IfgdDwI/%$5$7$8$9DH$IfgdDw%$(d5$7$8$9DH$IfRgdDwkdP$$Ifl4\ =(,y  t ̙0(644 laf4p ̙ytDw3kdiQ$$Ifl4\ =( y  t ̙0(644 laf4p ̙ytDw(($(dIfRgdDwHIP(($(dIfRgdDw%$5$7$8$9DH$IfgdDw%$(d5$7$8$9DH$IfRgdDwPQR}I/%$5$7$8$9DH$IfgdDw%$(d5$7$8$9DH$IfRgdDwkd6R$$Ifl4S\ =( y  t ̙0(644 laf4p ̙ytDw}~3kdS$$Ifl4\ =( y  t ̙0(644 laf4p ̙ytDw(($(dIfRgdDwښۚ(($(dIfRgdDw%$5$7$8$9DH$IfgdDw%qq$(dIfR]q^qgdDw$%$qq$(d5$7$8$9DH$IfR]q^qa$gdDwI/%$5$7$8$9DH$IfgdDw%qq$(dIfR]q^qgdDwkdS$$Ifl4\ =(ly  t 0(644 laf4p ytDw&'3kdT$$Ifl4\ =( y  t 0(644 laf4p ytDw(($(dIfRgdDw"#&'(fhijśƛۛݛ'(ڸ|k\L\@h)5B*^Jphhmh)5B*H*^Jphhmh)5B*^Jph hh5B*CJ^Jph&hDwh5CJOJQJ\^JaJ&hDwh5CJOJQJ\^JaJ&hDwh5CJOJQJ\^JaJhDwhDw<h84h)CJ^Jh84h)CJ^JmH sH  h84h)hCJOJQJ^JaJ h84h)CJOJQJ^JaJ'(fgh(($(dIfRgdDw% y($If]gd!%qq$(d5$7$8$9DH$IfR]q^qgdDwhijI'!%qq$(d5$7$8$9DH$IfR]q^qgdDwkdpU$$Ifl4\ =(,y  t 0(644 laf4p ytj(($(dIfRgdDw%$5$7$8$9DH$IfgdDwID88 $$Ifa$gdDwgdDwkdCV$$Ifl4u\ =(,y  t 0(644 laf4p ytě $IfgdDwpkdW$$Ifl&l(( t0(644 lap ytDwěśƛ(8G~lJ0% y($ &P#$/IfgdDw!% y(qq$ &P#$/If]q^qgdDw% y(]gd)% y(]gdnkdW$$Ifll(( t0(644 lap ytDw(78G]^ʝ˝ם؝ޝߝ ҟӟܟݟ ƺƺƲƲƲƲƫƚƚƚƲƲƲƚњƲ"hDwh5CJ\^JmH sH  hDwh)5B*CJ^Jph h84h)hCJ^JhDwh)5CJ^JhDwh)CJ^JhDwh)5>*CJ^JhDwh)B*CJ^Jph"hDwh)5CJ\^JmH sH 5G ^ǝΝԝ۝% y($ &P#$/If]gdDw% & F y($ &P#$/IfgdDwN,!% y(qq$ &P#$/If]q^qgdDwkdX$$IflIFL( ei ` t 6P  0(6    44 lapytDw 2Y}% y($ &P#$/If]gdDw% & F y($ &P#$/IfgdDw% y($ &P#$/IfgdDw N,!% y(qq$ &P#$/If]q^qgdDwkdX$$IflvFL( ei ` t 6P  0(6    44 lapytDw3]ҟӟٟ% y($ &P#$/If]gdDw% & F y($ &P#$/IfgdDw% y($ &P#$/IfgdDw N,!% y(qq$ &P#$/If]q^qgdDwkdY$$IflFL( ei ` t 6P  0(6    44 lapytDw B% y($ &P#$/If]gdDw% & F y($ &P#$/IfgdDw% & F y($ &P#$/IfgdDw% y($ &P#$/IfgdDwƠϡ١pqtu{|<=~ʤˤ̤ͤ橗zh5B*^Jph hDwh)5B*CJ^Jph#hDwh)5>*B*CJ^JphhDwh)5CJ^J hDwh)5B*CJ^JphhDwh)5>*CJ^J"hDwh)5CJ\^JmH sH  h84h)hDwh)CJ^JhCJ^J-N,!% y(qq$ &P#$/If]q^qgdDwkdZ$$IflWFL( ei ` t 6P  0(6    44 lapytDwƠS% y($ &P#$/If]gdDw% y(h$ &P#$/If^hgdDw% & F y($ &P#$/IfgdDw% y($ &P#$/IfgdDw ϡN,!% y(qq$ &P#$/If]q^qgdDwkd[$$IflFL( ei ` t 6P  0(6    44 lapytDwϡ١*~Ȣpqx% y($ &P#$/If]gdDw% & F y($ &P#$/IfgdDw% y($ &P#$/IfgdDw N,,!% y(q$ &P#$/If]^qgdDwkdo\$$IflFL( ei ` t 6P  0(6    44 lapytDwӣ=Ĥˤ!% y(h$ &P#$/If]^hgdDw!% & F y($ &P#$/If]gdDw% y($ &P#$/If]gdDw ˤ̤ͤK9"% y($If]gdDw% y(]gd)kdL]$$Ifl4FL( ei ` t 6P  0(6    44 laf4pytDw yggg[[ $$Ifa$gdDw% y(]gd)nkd/^$$Ifl&~& t0644 lap ytDw% y($If]gdDwͤ 456789bcdİplcQCQl=pl h)CJjh)UmHnHu"hDwh)5>*CJOJQJ^JhDwh)CJh)hDwh)5B*^JphhDwh)^J&hDwh45CJOJQJ\^JaJ&hDwh45CJOJQJ\^JaJ&hDwh45CJOJQJ\^JaJh45B*^Jphh)5B*^Jphh5B*^JphhDwh5B*^JphhDwh^J  $IfgdDwpkd^$$Ifl&l(( t0(644 lap ytDw05~gg% y($If]gdDw% y(]gd)nkd7_$$Ifll(( t0(644 lap ytDw5678:;<=>?@ABCD  9r $IfgdDwpkd_$$IflY=(( t0(644 lap ytDwDEFGHIJKLMNOPbcpkd?`$$Ifl*=(( t0(644 lap ytDw  9r $IfgdDwcd}ťpg[[[g $L`La$gdL`Lgdnkd`$$Ifl(( t0(644 lap ytDw% y($If]gdDw  9r gd) ť "#]^_fgklz{BRjkŧƧǧɧʧ̧ͧżżżżżżżżŦŦżżżżhT{h5CJaJhmv5CJaJhTh5CJaJhDh5>*h1bh5CJaJh5CJaJhh1bh5CJaJh5CJaJ h45CJOJQJ\^JaJ h5CJOJQJ\^JaJ4ť #^vmmmm $Ifgd~AykdGa$$Ifl''  0'644 la_p yt~A$ $If^ a$gd~A^_`a*!! $Ifgd~Akda$$Ifl4\7 'D ^~` (0'644 la_p(yt~AabcdefghijRkdb$$Ifl4\7 '`D `^`~  0'644 la_yt~A $Ifgd~A jklmxyzRkdc$$Ifl48\7 ' D ^ ~` 0'644 la_yt~A $Ifgd~Az{|}@777 $Ifgd~Akdod$$Ifl4\7 ' D ^ ~  0'644 la_pyt~AH??? $Ifgd~Akd]e$$Ifl4F7 ' D `^+ 0'6    44 la_pyt~Anee $Ifgd~AkdNf$$Ifl4aF7 ' D ^`+0'6    44 la_yt~Aqhh $Ifgd~Akdf$$Ifl40' +  0'644 la_p yt~Atk $Ifgd~A  $If^ gd~A~kdg$$Ifl40' +0'644 la_yt~AfYP $Ifgd~A  $If^ gd~Akdhh$$Ifl40'`+ 0'644 la_pyt~AkƧtk $Ifgd~A  $If^ gd~A~kdLi$$Ifl40' +0'644 la_yt~AƧǧȧɧfYP $Ifgd~A  $If^ gd~Akdi$$Ifl40'`+ 0'644 la_pyt~Aɧʧ˧̧fYP $Ifgd~A  $If^ gd~Akdj$$Ifl40'` + 0'644 la_pyt~A̧ͧΧtk $Ifgd~A  $If^ gd~A~kdk$$Ifl4e0' +0'644 la_yt~AfYP $Ifgd~A  $If^ gd~Akdl$$Ifl40' + 0'644 la_pyt~AopqrsѨҨ"#$%'()STVW[gh஝yn[n$jhaAhF,5OJQJU^JhF,5OJQJ^J$jphbhF,5OJQJU^J hF,5CJOJQJ\^JaJ he+5CJOJQJ\^JaJ h5CJOJQJ\^JaJhmMsh5CJaJh <h5CJaJhF,5CJaJhh1bh5CJaJh5CJaJ hT{h pt  $If^ gd~A~kdl$$Ifl4=0' +0'644 la_yt~Apqry  $If^ gd~Aykdpm$$Ifl''  0'644 la_p yt~ArsҨ  $If^ gd~Aikd n$$Ifl''0'644 la_yt~Ah[[  $If^ gd~Akdn$$Ifl0'8 0'644 la_pyt~A"u  $If^ gd~A|kdIo$$Ifl(0'80'644 la_yt~A"#$y  $If^ gd~Aykdo$$Ifl''  0'644 la_p yt~A$%&'()*5SUVXYZ[L`LgdF, $L`La$gdikdpp$$Ifl''0'644 la_yt~A[\]h/ $IfgdUgda $L`La$gdF, $L`La$gdL`LgdF,!.19;<HISUVªêǪȪҪժܪݪ⾰vvhhThThT&hGhF,5CJOJQJ\^JaJhF,CJOJQJ^JaJhaCJOJQJ^JaJ#hGhF,<CJOJQJ^JaJ2hGhF,5>*B*CJOJQJ\^JaJphhUCJOJQJ^JaJ hGhF,CJOJQJ^JaJ$jhaAhF,5OJQJU^JhF,5OJQJ^J$j$hN+hF,5OJQJU^J /019:;<A<gdF,YkdD$$If40%T 62 2(34ayt~A $Ifgd~APkd$$If40%T `4634ayt~A $$Ifa$gd~A<GHI[\]lmeQkd$$If0  634aytagdF,9kd$$If??634ayt~A $Ifgd~Amn}~RQkd$$If0  634ayta $Ifgd~AQkdu$$If0  634aytaRMA dK$Ifgd~AgdF,Qkd$$If0  634ayta $Ifgd~AQkd3$$If0  634aytav5@kd$$IfK%634ayt~A>kdF$$If%634ayt~A $Ifgd~A@kd$$IfK%634ayt~AӪԪժTPkdV$IfK$L$0%634ayt~APkd$IfK$L$0%634ayt~A $Ifgd~AK$ 45:?@BCEJRYmnsy{|~ƫЫѫ:wxά֬ (PQz}4)hGhF,5>*CJOJQJ\^JaJ#hGhF,<CJOJQJ^JaJhUCJOJQJ^JaJ&hGhF,5CJOJQJ\^JaJ hGhF,CJOJQJ^JaJhF,CJOJQJ^JaJ<e\ $Ifgd~A?kd*$IfK$L$K%634ayt~A $Ifgd~AK$Pkd$IfK$L$0%634ayt~A 5XYnYPkd$IfK$L$0] % 634ayt~A $IfgdUK$ $Ifgd~AK$@kd$$If4%634ayt~AǫϫTK $Ifgd~APkd$IfK$L$0] % 634ayt~A $Ifgd~AK$PkdH$IfK$L$0] % 634ayt~AϫЫѫԬլKPkd $IfK$L$0] % 634ayt~A $Ifgd~AK$ $Ifgd~APkd $IfK$L$0] % 634ayt~Aլ֬&'(f{|m?kdJ!$IfK$L$K%634ayt~A $Ifgd~AK$ $Ifgd~A?kd $IfK$L$K%634ayt~A|}ne $Ifgd~ABkd!$IfK$L$%i634ayt\ $Ifgd~AK$Dkd!$IfK$L$K%i634ayt\J`ajaa $Ifgd~A?kd"$IfK$L$K%634ayt~A $Ifgd~AK$ $Ifgd~ABkdT"$IfK$L$%i634ayt\45^_`bخٮ &')*/0236:>clﺤ||||jjjjjjjj#hF,B*CJOJQJ^JaJph$hGhF,0J$CJOJQJ^JaJ)hGhF,B*CJOJQJ^JaJph*hGhF,0J$5CJOJQJ\^JaJ#hGhF,<CJOJQJ^JaJ)hGhF,5>*CJOJQJ\^JaJhF,CJOJQJ^JaJ hGhF,CJOJQJ^JaJ(abٮm_____ $$Ifa$gd~AK$?kd^#$IfK$L$K%634ayt~A $Ifgd~AK$ $Ifgd~A?kd#$IfK$L$K%634ayt~A  E:,, $$Ifa$gd~AK$ $Ifgd~AK$kd#$IfK$L$r W%0634 4<ayt~A',kd$$IfK$L$r W%0634 4<ayt~A $Ifgd~AK$ $$Ifa$gd~AK$'*035 $Ifgd~AK$ $$Ifa$gd~AK$56789C8** $$Ifa$gd~AK$ $Ifgd~AK$kd%$IfK$L$dr W%0634 4<ayt~A9:<=,kd&$IfK$L$r W%0634 4<ayt~A $Ifgd~AK$ $$Ifa$gd~AK$=jkl¯ïįկhDkd'$IfK$L$K%i634ayte+?kd'$IfK$L$K%634ayt~A $Ifgd~AK$ $Ifgd~Alxyدۯ߯PVʵʣʑttfXD&h`9h0mQ5CJOJQJ\^JaJh0mQCJOJQJ^JaJhF,CJOJQJ^JaJhUCJOJQJ^JaJhF,>*CJOJQJ^JaJ#hGhF,>*CJOJQJ^JaJ#hGhF,<CJOJQJ^JaJ)hGhF,5>*CJOJQJ\^JaJ hGhF,CJOJQJ^JaJ h5CJOJQJ\^JaJ&hGhF,5CJOJQJ\^JaJկ֯ׯدܯݯp.Bkd)$IfK$L$-6?34ayte+Bkd($IfK$L$-6?34ayte+ $Ifgd~AK$Bkd]($IfK$L$634ayte+ݯޯ߯EFGHv;kd)$$If 634ayt~AgdF,>kd)$$If%634ayt~A $Ifgd~AHIPWXcnXNkd}*$$If0[    634ayt~A $Ifgd~ANkd$*$$If0[    634ayt~AnoXNkd/+$$If0[   634ayt~A $Ifgd~ANkd*$$If0[    634ayt~AXSG?$a$gd0mQ $L`La$gd0mQgdF,Nkd+$$If0[    634ayt~A $Ifgd~ANkd+$$If0[    634ayt~A%789{aN8#(h0mQh0mQCJOJPJQJaJnH tH +h0mQh0mQ5CJOJPJQJaJnH tH $h0mQh0mQCJ OJQJaJ nH tH 3h0mQh0mQ5B* OJQJ\^JaJnH phtH *h0mQh0mQ5OJQJ\^JaJnH tH .h0mQh0mQ5CJ OJQJ\^JaJ nH tH .h0mQh0mQ5CJOJQJ\^JaJ nH tH  h h CJOJQJ^JaJh 5>*^J&h`9h0mQ5CJOJQJ\^JaJ h0mQ5CJOJQJ\^JaJ 89:ұӱ$$If^a$gd0mQq$If]q^gd0mQ^gd0mQrsz{ٲڲAB_`12閾oX,h0mQh0mQCJOJPJQJ^JaJnH tH "hCJOJPJQJaJnH tH (h0mQh0mQCJ OJPJQJaJ nH tH (h0mQh0mQCJOJPJQJaJnH tH %h5CJOJPJQJaJnH tH (h0mQh0mQCJOJPJQJaJnH tH +h0mQh0mQ5CJ OJPJQJaJ nH tH +h0mQh0mQ5CJOJPJQJaJnH tH " (ZI5555$q$If]q^a$gd0mQq$If]q^gd0mQkdB,$$Ifl4 Fj1=`T"`| t0R>    44 laf4pyt0mQ(;MaoѲزٲڲ۲BDFHJLNPRT $If^gd0mQFf.$$If^a$gd0mQ$q$If]q^a$gd0mQTVXZ\^_`a "$&(*,.0123Ff9Ff`4 $If^gd0mQôŴǴɴ˴ʹϴѴӴմ״ش'?DQ =$If^=gd0mQ^gd0mQFf@? $If^gd0mQ'>DPQRS|۵ײlP:4h0mQh0mQ5B*CJOJQJ^JaJnH phtH +h0mQh0mQ5CJOJQJ^JaJnH tH 7h0mQh0mQ5>*B*CJOJQJ^JaJnH phtH 7h0mQh0mQ5>*B*CJOJQJ^JaJnH phtH (h0mQh0mQCJOJPJQJaJnH tH (h0mQh0mQCJOJPJQJaJnH tH "hCJOJPJQJaJnH tH %h5CJOJPJQJaJnH tH +h0mQh0mQ5CJOJPJQJaJnH tH $h0mQh0mQCJ OJQJaJ nH tH  QRSrstF99-- $^a$gd? ]^gd0mQkdB$$Ifl\).=$0 t0R>644 lap(yt0mQ۵ܵݵABZ]qrιΟj\C(C(C4h0mQh0mQ56>*CJOJQJ\^JaJnH tH 1h0mQh0mQ56CJOJQJ\^JaJnH tH jh0mQUmHnHu*h0mQ5B*CJOJQJ^JnH phtH <jh0mQh0mQ5>*B*CJOJQJU^JnH phtH 3h0mQh0mQ5>*B*CJOJQJ^JnH phtH (h0mQh0mQCJOJPJQJaJnH tH 1jh0mQh0mQCJOJPJQJUaJnH tH 0h0mQh0mQ5B*CJOJQJ^JnH phtH rstZ[]¸|j[j[jJ9 h-VhVCJOJQJ^JaJ h-VDhdIXCJOJQJ^JaJh5CJOJQJ^JaJ#h-VDhdIX5CJOJQJ^JaJ hkShdIXCJOJQJ^JaJ#hkShdIX5CJOJQJ^JaJhdIX5CJOJQJ^JaJhqOJQJ^JhJ OJQJ^JhqCJOJQJ^JaJhF,CJOJQJ^JaJ h h(WCJOJQJ^JaJ h h CJOJQJ^JaJtҸ(09BZ[\] $Ifgdtd& $Ifgd67Ff+E $$Ifa$gd-VDgddIX$a$gddIX $^a$gd(W $^a$gdq]gɹʹ !"#$&')*,-/?¸wokokokokY#h @B*CJOJQJ^JaJphhagjhagUh\hV5CJOJQJ^Jh5CJOJQJ^Jh\h\5CJOJQJ^Jh\OJQJ^JhVOJQJ^JhJ OJQJ^J h-VDhVCJOJQJ^JaJ h-VhVCJOJQJ^JaJhF,CJOJQJ^JaJhmvCJOJQJ^JaJ]ʹ $Ifgd67 $Ifgdtd&kdG$$Iflִ 9P%O,2;y,  UUUUl t0|;6    44 layt-VD #%&()+,./@Nh$a$gd< $a$gdU/ $^a$gdV^gdJ ?JLXghuwúĺ۷ۥɷɐ|||q|hdYhh5OJQJ^JhaghAFNhh0JhD0JmHnHu hh0Jjhh0JUhh)hU/hhB*CJOJQJ^JaJph#hUB*CJOJQJ^JaJph#h ZB*CJOJQJ^JaJph#h @B*CJOJQJ^JaJph#h< B*CJOJQJ^JaJph#hhB*CJOJQJ^JaJphºúĺ)*+,- $^a$gdVgdXD$a$gdXD$hh]h`ha$gd!{h&`#$]hgd!{$&`#$a$gd!{ hh]h`hgd!{ &`#$gd!{(+,-h\hV5CJOJQJ^Jhaghhhh5OJQJ^JhZhh5OJQJ^J@ 00&P 1h/R :p(W. A!n"n#S$7% C 00&P 1h0/R :p0mQA .!7"S#n$n% C 00&P 1h0/R :p0mQA .!7"S#n$n% n"@ߠ ׮Кr_PNG  IHDRgAܠbKGD ;o cmPPJCmp0712Om"IDATxݸzz` O* ~|: ץ_RI*Z=ٻc{YUKtIhu(@.hrA+ Z\ V 5/ Mk>E-Ԅ 4v\>G};;&~q =CCjbд I Ԭ4%j4m;jNhM iv)?yhVG|1KBк9?% 5h>Hue]j!i:a7wh@IFգAivm|Ӡo{|(O ֻqB{ ͵i"sRGmI@#VmD;h'ǣA<}'ͳAy'ߠhakBÞunЇFK]g_Y{+ g/ 0.r;H,tm/#q @5Åg3t'AI Լn>[ժ4Q\5ZnS o,r4C݄Գ]B>=vD[tWPLu|I0?jЅ֫4n-4Z y'E~uq'EjK#E-D IВ-PTr -LɫUX[ LJ mVTϞ:jghW@UdN$9)F(kRhD8h lك@) wTwP nF2$jEˣAE !anYe ?*9{/uB"It&&NVʅZ&ŵhTnM)bE"VT\}VL] M***) M}DZUgMπV,U +w.LlH/ldt*\VJBVho]6=dgUTُjn?0*Z2۳_ڟ ZuXkw4y5Zs͵;Zu%Qmu;"Zu%274j Ցx9휛Av ij]WB@}VghxHrZ<5>:A 4Z=^Nlv],pY&@*_J Vk(f6'4CWە \m:ṔH;]q3 DZs ?FZ=G^)u@YfUX*f%b *˪CߝpT -# +0(ZYQt7eS#@*\4)VR 4: dć3Lk54m[,{a y >[{گsdq=g=fetiKE¢[fmTTDcd*s^#!eg-C͓>2מМH#f)/ni<HsUXʘ}n͐,Eǖdϻ_%-s#}H`԰su2f/r0)@JrSmO`/r3loTsV,f({ 5иKҊYnz qr5b*S.ʄ643f#BʡivfP~V BPI4.f _A Kk\ȃfYʃFA=jbU&1GyT MhBf{Lidwq,Z?Ө2=Qiд}i4f K5{g.nO7̖j"-1uTFre5>|T$8VE())G) ͰڡyWh燚/DRVt{lCc9|5*n,^?m()^-Wֻڳ]FeG~:x.Vm~ÈעQG.llwG:6!40;4!&'@EA=k5s?#^m{=@~Ӱ'ڽ,JqMeRv3.}A_CЊ8ʲ0!Fs]NC3L=ZQ͌Kn@# B439p.>ni@u2P | -ۧ M Z(b3dݡ d@33[A4͒\h()]W64 BSW9PaBy`1!;zpŋCrCŰdx/,hida ob.p*CBHz@@4J]RA[Y7E^34Re i)q{%K3 dG`J( ^C7X@ZV8+̃-h&;9p*gJXNyiDsDn9F)vF=?Stz=;kt%F h^Bc0:JD (Z`~\ z/pNvKusĸhH=fṟFUOg:2Ĭx@qBi'ǎDy232 z\a5R\fy?4Qfd[hI@LRnVK@C9RCQX0NM} F;4k蔦 lIYv*hA3AIhxSqS{$Ԕ&u2]ّix*|Ϋ:i2puw4JFxgb@#jTuwsS#+v-;9J5o5 (:+pҲ|"Ll| @mm)Ƴ$XʇsR6wS"m|>˙@73͎4h q^[cuOhXU^j#Z{6S?ZyЖ_6kF7茀ch -i9n.d?4Bz,NG#'XܚahzJ&4f4g>.4g8i\RQ$ PɷucЖN%d7 ֑]Z -4Ĩ ᅡ"H*IhHl|V Jn 4AVSp78 <-o'ogݚ*5:v3Lfكyr1o2Jqr>4TtPG)5K1SV{(̕_^ >kY)uVpUqix@SI-}c>{'.:jzgCh'pmjif*pC[•!-hJzih]X}VRmN" ڪm%|c½e `hG4m(w"Ņ6_*lݡRsCnHx@v)fd%,zK,hܜ ,U'%( Xtڃik~4 ]^Z2ڤ!j`֥ښ|h˦;4r8j5O~(RM/YXQHڪ>j_rڼ&M( U4ptC-.X9 mm?/f84)VN-j 恥kp&@N[iIM5bhMrvϙeI؜%yRqxo!&X{^=FG@3yX}bOu,碳pNxᙷ&*(qNX6]^;mW /8kj ndFs0 : {#VA9EڴA 9&9I9&MaX}8mZ<2dqsZT&wFe{ޏ'C7tY)Μ1X`h%+lA@wiB8NVƀt4I- :y7HNRRU rkhhISEķs44~*@C{.N ;ůyy}`wY!c5W[E`}4\5Z ϋ[ϖSFeM}dzPB5滢n")'ґ.{F #FZM-CCK\.;NKY 7D6#Kh'"_7a:8&i#Md7kc76OG=LҤpN.GvGM]ɲ&esڢqo- élN[N`9Є=344asFHկ,6655.l//]6ΑKBJ8Q`3moEbIIYhˮ fs4G ̽;_ۦ鼠]B:~gG-we49֍66Ol"TK hSWh!hl[)lWs>pSe]v`IhMGIrgx gmi6Eol{zˎrBb'Uig@k,4 u#Fq jH]ޜsiHA$99NRZ ySc1BZDy<@,hg 9z i=\F&]rP$Y]6bJhא#ZUAh{ Z\`|@h}p͠|Zt}fG4ag Y.<=q`Р4m_$М&Amm@^cGZBdֹiC(ҺL]ChcG>6&pN6~iLhmOx,} w}#͂#mc?KJґ6Wq<~ұy˲I\UJBڔic-4m89p740e:siS. ASy{9pUk&`x=:4U'Nf'oO2Lh~džЊ;~PȞ*u= B!F-&`W0К> ˠ9MgOf C' ӛjZᛈ#ByĸU(4CZIhFYR͖5aDckhfE$3Zaw LUq$94kF`+sV (P=lU*;44BVPY69]\!cm ((߂YeGS*jXpL8j |;70յ@YЈF5LjCgC VXضS' ns8h3*ܑ3.42wЈU%H˹ bЌ&04 ?[Ѫ\gKhEH OOf+lhNtΦLOV%4X^? "C#&/+bЪt6vBhWev)Pִ84rT).j3"rBqZNk8hk$+B4j-XMDiShX :*~,7FTpcA[ǐޞh+k Z~ |2&/d@e+t66_-]$4Zݓ)hK%8QV4Z/l mFjJJuavA].hvAV.h ڰrA]І 6\j @rA+ Z\ d\hgwEvA * mX].h62?^}^,f9dhg} /v>gA1kQ( @{ɂ a<!}n۽e^:@=rO5D}6Oo\i>o4myh O_" <2t~{xV\/FF+XnoG |ﴃWho{/(E|aW?_?+iN/Oi3ޭE֜6MY8Y͊ ŀD\޿+:|]omvmu(h>,Z~r̭snF7Cݒ@%k܇JmiGhiF߷<h9i+6Z;Ok>vw{mxo?7'Ot3ďB{qڷ;Դ>|zڡ͌!@i D[;A{uо|dM~nknl#x;>^4Ƀv ?^@{H.5x;>ziMО!׵#@4NG__tiϿ5ok,=mCou-·{dϥ⿎>gC{cXX:{}@>vNr4mͶ9K}^N~)Ҟwzb8oFeFa=a: Ov\gD*>5 ׇ4>Xnsh8Huɝ'ݱ۽],k1syc7#i/?e,kvdNVv^MP汕W1̐-ۼ7) x)>Q̩O8 bW.R-~Y1|[#HOE.Y)8Tk鶊e}:^N/jk+mÞƝ~b9ˆ@.)F+IE86mݚ ]?ѹ\ @0^GoOժ>tdTސs^ok7g[ֻzZ΂O٨}5Q>/?ǥie` \>|-(L~-Ϯ?ZrᲫ,} ick龿Ybgtպ^E@.dFb_Z{s_]?Fv'YDXz=Ӎc*'Vv~8q% #2#'?lǂzy^Fv]N5Y]>de=z7JʧGB0:.c~tq~;kgau_Xc6zy5XX1ߍҾU-ͺ, 6~"9O!C9 b@$Hlh@Pۀ;+K~~1e1%ti'vrBYA5e"c"@TI%)BE4qk+iyk4S;/7=/wn>Dügٶz_.NS>~ ٌufb}K$}`GP+yRSM2`tMֻ' ѹgzۨ~عNվddeb_F-vXkY?3oVQgk,c>=+^б|HVY_V?X:`4_a[-\_t,0mö-mo!Wߥ_NϠW0.\eurqZ c} uζmi)>^659ֻh(cuP- ?N2lfn[~lq}c}tue; ukc]S_2- v0tTN%9k'9bJ{ԗ2nV~]K' 0s)`{uq-US#~uѮ&Usf=UY~\OOU-J{ӫe6[ciw.WUmj'f}E~Eݟ^=}F_K{?=SI2aU/&ݔFE&kvO]{m~ /,=O}](ο#_Xs}[YCes=l?#l̆u/^׽:k-^];_g쮽m)B'Xme-kXm*JT*qk[$=p-8E^auGk"GSۋpO]i)򱭨]}-5GҗچΧӬf%y5?&zk\gƃpkniоYŷWhU]ytO8$QA 9^9[({;=)?Fs~.}kA;:Gٌԭnˤk+;?S>[ ָz8&UQcWo׵rMOo?^ͯ_H{15ٙ/_}8_oIY%;+ecR+,vU^kHq-nƻn<~Һv>Hʷ׷!9z݌[x=Pg)ؖfPpuRJ_-^:ϟwE ʢL}V.~?FG+߁ѱq(u?YeelggozW-tAmqu ~Sj־AgP ]nEoȰ>c-]^b׾>nU]Y"*e,s.폳{SuSV7\0@n[Sk{7e~E]O3*V}!N9>k57m[-]s6N3z-(cgX3}Oclk?lYz߬OWnN-xcg9Y[Wo%=}+tN݅i饮vmR~.oF][''t^b: Լ1~#]/Jo!XbgINOjozXM[[e{=އw]a\ʦ;WZ{Y%>}A'=f_U8X_^U[}9cCmf&*^_~xơfXvM`X+^bJw[[z30gMf;w7sk,kgٺH7Qr:7wU?##Zvg.£7|1}uzeeVWʽ6TM?cs&RZ^ʘr.e }^W]^OSJzo =c}YY.nev_ٱIk.oZ=W6+gLͻ)2N5%?UuϩTu8]mo잗ւۅaw=t$RlN1}'Ym},{V-'`?{6zfŰ>guL1:XݾY]We?!sh['B&R/ȑ]G2ތ+er1zEΥٺsK=\v쭞]߬YR3>e?_zoUWWPc*=MƺcHdh/~F%ަU^;*Ⱥ3o,{K̶1N QCk1nnUjoӋ:sFRn^7O-qgCv[鉰:.wg)X}rNF+q>ϴ@gOاҳGH}fs=iwkj7_n:^^c3s>^6;3 6'k+e_M4aoMqx:/t~}[f<tM6ˀe̳o|nOxVu;w\}6}k[cϰ[k쭍~~ŷdٓf%.kvWA׷꭫gbɀEz`dc?ԱGgu_WFgTDm"}V6]z[v,kzY7u E ve;zoiu?nKƵّ4 a>c}ΊG#6XcZ>9}},qhr7i8>:+Ywzlm[˶ڹoa՟neZlL~xXFS}VݺNzͻzA؟YU9nm 0e}Zkz+)`/A#;5mԱXJZr2Ey,7۷WmVZ)ֻni6WYcv7sI?Hv;,~-y'=s\{[in1 *qP)\zI 2$D:qUev[T:VO՞2\ 匥ެܜ+nïK2?ZT|:qn,Gn͈}?9NkoU3擲~ksDo5f/smm7WCڲY c'#ja[;8\ovyv?~͟Mk,o_u7gvPLYc}*Y__?S' mS !TI%)W&kvjqc~׫ #7T|\t5-Chk6Fne{#uX zq}Z))Oz_WӇ8xoĠ;es.szn}- ]6~I7_O }8\3)km}^ns},}.'@g5Ayt7%ܴN>kVoޕu8RVS];w9-祽hݑK \+6mzxV~ϡk$rME~ r5o;Y.~qۓQ6>1*u}9ȫRC~j|CҸwZ CcQ.'oo~l3,c2@vWsMVL>Gqݮ׆ gΞ\fڿf[ַozmelN>3_x!]8[gҳӹRR~J֟j_M,.\MbwUu$SU N Photoshop 3.08BIMZ%G8BIM%}Ǿ pvN8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjc Proof Setup proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMIy CMYK BLACKynullboundsObjcRct1Top longLeftlongBtomlongyRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongyRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Y Adobe_CMAdobed            Y" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RI$I%5:Q[\d{Cy`3b{ 漎Cjcە﮿?k[zv~{ha'Yw=Zŏ,Ru&O~8DbcM[i0Ř$H1bt7{q3\}¦zU˰zD9qn[߸U+YA+] n+k~Ym/Oc./gq$L #$>ɝ'ݱ۽],k1syc7#i/?e,kvdNVv^MP汕W1̐-ۼ7) x)>Q̩O8 bW.R-~Y1|[#HOE.Y)8Tk鶊e}:^N/jk+mÞƝ~b9ˆ@.)F+IE86mݚ ]?ѹ\ @0^GoOժ>tdTސs^ok7g[ֻzZ΂O٨}5Q>/?ǥie` \>|-(L~-Ϯ?ZrᲫ,} ick龿Ybgtպ^E@.dFb_Z{s_]?Fv'YDXz=Ӎc*'Vv~8q% #2#'?lǂzy^Fv]N5Y]>de=z7JʧGB0:.c~tq~;kgau_Xc6zy5XX1ߍҾU-ͺ, 6~"9O!C9 b@$Hlh@Pۀ;+K~~1e1%ti'vrBYA5e"c"@TI%)BE4qk+iyk4S;/7=/wn>Dügٶz_.NS>~ ٌufb}K$}`GP+yRSM2`tMֻ' ѹgzۨ~عNվddeb_F-vXkY?3oVQgk,c>=+^б|HVY_V?X:`4_a[-\_t,0mö-mo!Wߥ_NϠW0.\eurqZ c} uζmi)>^659ֻh(cuP- ?N2lfn[~lq}c}tue; ukc]S_2- v0tTN%9k'9bJ{ԗ2nV~]K' 0s)`{uq-US#~uѮ&Usf=UY~\OOU-J{ӫe6[ciw.WUmj'f}E~Eݟ^=}F_K{?=SI2aU/&ݔFE&kvO]{m~ /,=O}](ο#_Xs}[YCes=l?#l̆u/^׽:k-^];_g쮽m)B'Xme-kXm*JT*qk[$=p-8E^auGk"GSۋpO]i)򱭨]}-5GҗچΧӬf%y5?&zk\gƃpkniоYŷWhU]ytO8$QA 9^9[({;=)?Fs~.}kA;:Gٌԭnˤk+;?S>[ ָz8&UQcWo׵rMOo?^ͯ_H{15ٙ/_}8_oIY%;+ecR+,vU^kHq-nƻn<~Һv>Hʷ׷!9z݌[x=Pg)ؖfPpuRJ_-^:ϟwE ʢL}V.~?FG+߁ѱq(u?YeelggozW-tAmqu ~Sj־AgP ]nEoȰ>c-]^b׾>nU]Y"*e,s.폳{SuSV7\0@n[Sk{7e~E]O3*V}!N9>k57m[-]s6N3z-(cgX3}Oclk?lYz߬OWnN-xcg9Y[Wo%=}+tN݅i饮vmR~.oF][''t^b: Լ1~#]/Jo!XbgINOjozXM[[e{=އw]a\ʦ;WZ{Y%>}A'=f_U8X_^U[}9cCmf&*^_~xơfXvM`X+^bJw[[z30gMf;w7sk,kgٺH7Qr:7wU?##Zvg.£7|1}uzeeVWʽ6TM?cs&RZ^ʘr.e }^W]^OSJzo =c}YY.nev_ٱIk.oZ=W6+gLͻ)2N5%?UuϩTu8]mo잗ւۅaw=t$RlN1}'Ym},{V-'`?{6zfŰ>guL1:XݾY]We?!sh['B&R/ȑ]G2ތ+er1zEΥٺsK=\v쭞]߬YR3>e?_zoUWWPc*=MƺcHdh/~F%ަU^;*Ⱥ3o,{K̶1N QCk1nnUjoӋ:sFRn^7O-qgCv[鉰:.wg)X}rNF+q>ϴ@gOاҳGH}fs=iwkj7_n:^^c3s>^6;3 6'k+e_M4aoMqx:/t~}[f<tM6ˀe̳o|nOxVu;w\}6}k[cϰ[k쭍~~ŷdٓf%.kvWA׷꭫gbɀEz`dc?ԱGgu_WFgTDm"}V6]z[v,kzY7u E ve;zoiu?nKƵّ4 a>c}ΊG#6XcZ>9}},qhr7i8>:+Ywzlm[˶ڹoa՟neZlL~xXFS}VݺNzͻzA؟YU9nm 0e}Zkz+)`/A#;5mԱXJZr2Ey,7۷WmVZ)ֻni6WYcv7sI?Hv;,~-y'=s\{[in1 *qP)\zI 2$D:qUev[T:VO՞2\ 匥ެܜ+nïK2?ZT|:qn,Gn͈}?9NkoU3擲~ksDo5f/smm7WCڲY c'#ja[;8\ovyv?~͟Mk,o_u7gvPLYc}*Y__?S' mS !TI%)W&kvjqc~׫ #7T|\t5-Chk6Fne{#uX zq}Z))Oz_WӇ8xoĠ;es.szn}- ]6~I7_O }8\3)km}^ns},}.'@g5Ayt7%ܴN>kVoޕu8RVS];w9-祽hݑK \+6mzxV~ϡk$rME~ r5o;Y.~qۓQ6>1*u}9ȫRC~j|CҸwZ CcQ.'oo~l3,c2@vWsMVL>Gqݮ׆ gΞ\fڿf[ַozmelN>3_x!]8[gҳӹRR~J֟j_M,.\MbwUu$SU N8BIM!]Adobe PhotoshopAdobe Photoshop CC 20178BIM http://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$]moniO<IK$5ʺfn]ח}~lmOD0I#KvҊJ+1I uu%z:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{UUMEO5]eDSU4tFM+$qbP< 3ƁTId1H'u`fO,n"=qJG~ڳ? >oA}gxEiØnb<-a#G==MAdF(?˯{H/oϏ` v݌voT&gG揄Ge+W{aN_SqGGt6rIT}GGfrZ/kkVmbAɶ l=اcزjeyHl?-A/ee=}$>:Y%Ᏸݝ݄m}k$7 dVFj~ΆvV,w1I{ۇ?׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{EvVn݉3alӼFІkuAઘ(Z*7)]ĩ7s.r7Tk ) M#%={%=k'[Un< *g@X!6yGmz[3EPEt|y'|3J|iY$^{wB\V˟`=3`߿w9=З3վZ0Y`߿w9Hn=ǻ՛[vnOk鲹^=xꪥn:Ɛi_zko67{+_Y;PI <4rܓsӾwss+nژfB|zW{c]{{uNMݛ5?7uvػ17To*:| Ep(j4Ĵ1 (= {g~r7-]lVyc+41iR,jc_3㙹yy[[XV'J5XH;{}.g}?\F /CsIAuk쮽v_7{*Ǹ- 9 ;"ZG**74]l?MOX"x^S^DeNdN_}/`ZM%uO*?uD*:lu&>? %-=,@bH 3frI61q vr59:ډ ;"}rI1 {rx-/;Eݷxh f€*.aw{$5ӗbĉf ,I{ٻK`d{/}4-mu9lQy){sN5Xج0hZY BH|mʼ{H55;c0@igDf"PʦZ~On6 d ;M0+$G b$CEQ 1TVazz}kr8*ڞ m՛nrpR+Zi!a+uo }dw41JK 0AN<3Xͳԁ<^8©+t^>u+Loכӳ袦VSP@D4[P&m9C)Kkx'3"r|ى$zb>n4s515JPB{ : u~׽ߺ^x|eVܻ?-SSkr"Mԥn&Je[űYo51̇Yteo;p.mpxex>i/*廂^-=]1{o ;<}zI#3y2pXvT(j]lnO#>?Qyryfb-aUP o3$ hi:y,tssw3na1^_$\$Qk#E kvG+O{>؟}մ}Y[':u[ ~Ku~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{_gt< n,j Su laʿ֟O",k>_M Or~^cbȤnoViQ(uzuz9{]{߽u~׽ȤZZ*j*vzjyh'D!P27_SC2)VR*XP<yY`9ᐤ AȃzƮۦxM6{'|TZ 63~rdܓ*n<1šL7!1}{o͑s!r7F2RL%z^~{CcQ4[7C.ޏ?[Gq0G-.{5ivD{5H?i39[1,n^3 ?(׽r_Q^|?O[/?p2谛; Y5?[ck90d0Ab ̪x>_?߹ۊIo4$:Z?5I.?W.Z=ţ TY\ī,^D~@v$um[zMV; U+ௗpW->9d_y?Qb?ꗵ+&G핐u=Jp{u\)y"qv>Lm܍N {}>8\ڮ9ZsG_ϭn?L(q1:ߺ.Xx[Y4o"s/׽u~׽ߺ^sItڡPoSMVU#'чݏ[4z&m;aK^8oO)~imI%ܞK@GȬ!k׽sP^*%[GJU=4CTuRFڒi lO \H4,x*% =;2 Zy*ij>duD=K6|}%K=xz Y)wikKQY€^F6]?r;߹z|M52' 8ݶ-ێ@.VccY$<+Hzɧ~g{-3sk1?=f/3TݧyY"IQQeREQ{ .{\ĒorwNwC% &MdyG\w2YW P`N.#U}m"{{UK; 33*I<z$(,ƀu Rz ln*rF"ꄂNӽl3[+5tm;]cl?m:#x6*Ȭ>2يF2VF*C |=ۭu{)>B_hqwԚdRujEѱ1HߦR ;o>gӶÜ-,ݽzC~ύuոK~/qR uf[V]}~o=A+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{[_g~=u=EpZdk8z]eUɽ+QzvN?_|~c/dVQ724Qk ~N:QL]vA?ĴJz]=cu~׽ߺ^~{kOWUr1fӗ7;DF:ͻE?Kq{4vl{PlP'1i4w飯.׺@]msqvj^ -K#-֛5{#oU|_I|i#risݚv$0?/Tup\~h:ŷ I._^g?? jv5*gVx&/ %nY)b{~gPx''w+-H͵]\x % f+s#dks-&ҒR]r2cϯ{[rz^~{NSk>w[ͽ&1MĦG!gQcOOʞrdrfp,1Pu_.[(mP[LO_^io|{߽uhޔ]o;2z?l-~ Wg* 0PϳUخ9sm+[SR%n:&M\niS=xi&!fyNwe2y 䩮w?yYP6v65pTE |uus=̅e,ijO^ڎ/Ovzn|1]Qa~i£GzX۟pO?{,&LFb[ZDGI:Kronvsy3#nRz?/kWl#gꞞ{l;kO޹rqnU*VpNO}yh6M{)k8T$&@F@=tS>~赔۾ S@gд15r n׽ߺ^kc#bzAYQvgE^N Q uH0ս4?"GA#:/JyCBsv43qo gQFHë B{){ͻ4k~X"XY13 sT{KQ=_[`PR -9gymy%YZē<|ΗRso5;õIP>JTªun^R;x9cl Q@ 8UC1>lĒrI={ؙ)Г{Gn޼HclC"v.x7QVBo+og{/3s'.L.y{/.ki偁νnܿo7ݎ(VxciI:|m][YSr' +}NGp8?eIE5E~rF{a|BŐc[1OIWOXοt/eT{5bw_~, 67RCAPcq4㧢:Z:HpĨ{ī뫛ɚKgwl;bIj ;k{KXv"(UPT |G+O{>b7ViGӠWЧ|^'^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{OOf҂GԽosBfa p۾-uSʟ}ra d;OEl}eNO~<ޙ;u<Vn]{؛ҽ}7lwU|Q'bv.ZXcX,bƐQT>œ̉ɼ&;fuuC!yB$ %́[ ڣJbkR{}WNZڱTN^TAʀk/Fl.a۞oCu". FH{{I>i+6dG"7$M.>L:Ӡ^p?'ѧ ]WnycRD7~٫~Eu8>|a7ߑ^6 nH~uTP9s,߼pl˦z؂{|dQ Ŀ9i׽g=v+{S_[  ޻iYL1}-JNʞ?9HycxAX]7|1hėHu|bndm}i\-Oɏ^u~׺?[v>)nĩvke>}68?Eøj2'?9f)+o=ԏ+Vu֯.~z #O6Ѥi%3{<vG﯎EFjnS+mٗX)[UٹCi=Ϳݭ/{ΒG[YFޟOO(龦D?bwoJ9?ǯ"?~Z={޺^w<{^EqcW'Wݥ =I]-6mōTj*|ȲS0^C%ahJK9{?kE4 uϸ.rm㤻q/{4ȵNj_s>W}$U^#eW׬ussخvtMEh?Q8/J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{s)*>vvK_!혃܇mJh<8*R}Z=(%y>s3ϯu_="ɪ?#,#P~]{y%v}z ꊉ׸ع%ӨGnV0؄}לǽXX}gs_w^q$umd?uQSL{ܫ#Ǫo^,'#tF O#%Mm@M 6K3H7'w=X}y6mWʫ\[S}s8(97;o5-7,iL2mIO7 VT__vb3}{ŀ5mf(RԞ9Y${w-s*')CCrLV^ Je7_^Yl{{6ʯ1?b|ݙl^޸ **cb1YZ 4gơ员ݘ^Ơ>gi E/$3 Q4U`G^uѱ{YP# ۘ@X$UZ4I9'{R+o_wWeZz1^xsno^w>eW|ؿ{wWeZz{Scw[z7`88vhm6ܧ{v49ZX*Qcsj44 RW[nMv@vѢ1,1Vd/hIZЕRE@6gmqۖA y8I$e 0 J׽]z{^^ӞFfӥ>'6uO UqqxAC_'!rV-ibi}=z#~Ϛ:I$ }R S׽g'n^iVW^Q(L`[PʟwQ9 9ԽٴMn7o(Oa8ez|4pu<}=Kڝe!׿:Z/`bҖ$#!&{FjJIਦ) VXfU*2 X9^PAVR*#FRG$2I ѲJC)A9{Ω׽ߺ^!mMn8woTێ Wi+֒hP9t ,C!ajS睭nq=kjI(Rq5QǓWA-g3rv⛷*{~?4dm$SOg.;gd{So )v`SVVaTl"a<)$ҷ{ܙ%N.Ϲgc/u՘zz_n><ٴ;,{76`͚<[}Esï{>MMTͯUBJ=ɶDYL\MRcfYPjs='>rs=|)pNAYA%@:臷GO~LbiGO 4-GCQJ3^u~׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]/6wfGVlެ޹|<SYۅ^C秦/{_뿺~G 9i~΀~GێxUL{]̑oP~}{#_?{߽u{|:Ȯڞ #]bYӖܹb{X}q70LJEf)p.^wp [{D><4xL:_$9RyKk;[pHCsRF,HYc<>|Vynm;0XmBhQ/HvroߠUy@xGʲE+zuzl{?\{{{ݫ:7\=1s k&H2Lϭ)ٹ dnUx!x%o_u:6Sx71M!@uOi~[iYZ,%smtm<2~uG{??w>wx޴1ڣ}y[v+kEqe?5^S^+SnU]=cTBO.*zmѸ1S0?EXc…$=9ۘMlٶ>/-?=4̚<<\ |]Sƕ#媤^pŏ0,a'KnxRAWH{TH̳z&n$DEAT~׽g}UiOeWy>w޵"SymѸ2 xn{y^CVޞ۷[Z8REz^gcIn&k4%?-TbN:{^{{u׺{^{{u{wǜDǴfZ+ZlGycXzf)!_ώ%>yl{zjH]GI- 3r=E$j>J:z]`c;sX̉?E]Ư"]orԵXj#`Zvov\vn܅B EY_1TQo~;'Wɗ1m%ZU`Ehfo2+92dw|YWXM>ig50lƵ^c$Dk?nmn͖Pm1Wnf830}-\ՈIJ_:jLf|J{~${{uV^ߏ}5Sw` M+д^;sEc QK:n6A?rgp.s#n*ú7 ,/E*V"#*H"L^e,7I-whOkFOHd`A{ޟ7#m`giv`H3SɓG&YquPg=Y~|=ow;Mϓ7 Z}}En@ RaR{쿺gek &rPx`$D뫸0mK{hdunr?ūi~y?{hS>/J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]O#WkCQ;$Fv*BQk0̊H͏'+~wxͶ]]T"i8u}nc֒Rmp0^WN׺?]s 5]uP˦I1X&8T6cT>s\ߦRJų6y %x)q?%vGߺ=%w;)U`x$#ǯ{?muau~{e]rFq2UDTQז&2ȊAy?oy39kv?_tZ @-KIz.iNk`'Ynh2溵^{g1Nٻg3sm}TFmAZVҺx[ѵod&{m7G2,ߚ=|mͺn[>IU"r){.u{ ^]љ=h7{ i~*r{{rI<1/_\^C[f g]H9T_F>>ܑq- , NC{z=O]m~yMDq~윚#` }ۜ=XX}gswnp94nrXfY%=VL?:&~蜹aוx[mx/ &H<k/ gZwlc*iz|<5D&'O~휯qݍ ݢE1YP~F8~Wٟq&vK 1%-c#e#:=׺:Q @|Mv6mg!`EAǒWxw죩XO xypka-m ),d Ȅ׬&Xo\WʡpAu8!e7%{|&X{~sAu/_ ~d={߿Mx/vQ^- "zc^#½[7׿%'E@z; ~l?6^oQS *%< &*) wcjmw?le'/u,^WxQ.V$Hs@\L*hf,aؿz\Q(H U&d?׽];m<~l*+g249:ꪔq>˷d7MYK<"Fz_m6k[~lï{:-ٛWl:xSo*;Xl] i_J覥Qa[w[˙g9ُ_DVo{nfQ{P{-^~{Nww 'Sdu_kd!$FS=hvwRKr#z =%'ܬ⸱trFFX|#{SrCe=w:4mK`UV8%?l*X*ccs/k>>r;|&.N_]MsxKeo8%+mƻVoڱGt^]~EkLhUU YvRIu5z1UES5tDfC'Z=߹2xJͬ-ͫ%D Cʌѽ֎̿u}/gٹ|C5Dcb uYe[ܿ]׽ߺ^~28~O[笢pҳwu;A:b *̬ц9?uH v6= .k?pgn& .5ȴwj#O{^Z>h|ioۧܫO>fj>ߨOtⷹ{ϋҗ\{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]}vWo??O>;26Q흿4IK&|ܫ^.coO6`ҎOyc i$31^o׺κO/x>ַ Ի6ltxsO7*ۃVosϿ}/Ʋky5) 0Ӯ{5_j}Z=3CۙF%fwOԗ׽3z_yj*Ow'  h~i'nePg:^V 7zt^.%NtDDm,Qڜ]oO޽oG|Ʃ+#qZXޱ{{GgBv^LǷw#4DOckdQ;8Ժ~p;#fwPVr`X'^\"s%4lqYUr@O:Ǡ^~{_}SOfgukrӫK0G˿)jǒb-"AƸI뢟p\׹{Gq4`'{ٶ|ݑz[J5[63p A{mW̲[}fHOUz>\ڭ`JMuz_\{{o|ڪ%V[s}d?=ʹ>TRU84>Ex,iI:}򳮐~׽";z{< X}Bą2e0w!Y</J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{oy QcgVgE&zB~G$,?}_HF{>~eBH ۚהeT[[2#)$ $qjhTDEUUE-݉bjI$UT* 8׽׽?'HWyc<ޕ{G=4Ig]45=]\znmI@Kߩs9_?s3Rv[A86:G4ޢ^ o.JnweA)EM*8T?}{߽u~׽ߺ^Io7䚟Y|oE98bFVr?㵤ٶKAN `ho:g.~Fqx6stkJOʖڗzvG^O'*FSpE,q{^~ζyqܯ>s7%whԞ&;(C>^%܋ɜV; a%ܥH?=ѷï{o}:{^UKq#3ݣbV#.JI3+r8=M2rGQ'~boI&}ODU eOO]/c6[Lj:O1~3{I4ϹZ)̟PVO^GN׺@oolmZYn~1U]op9ްaG|v&횪~?,)qc&ucrTUQTQc"Ot. IȘM:[dnviUwT uVWWJ2[.n{c}73E Guv()TXZMU!Ϥ@x 5r,qnޟVU9܍_C6=ژnΔ?v=׶<[JnH=>9<mc#+hCm%HO`ᕾM;)OSKGg8O~*oː2 x˾}>,#T-hg " [#tHd{de7ɾ1V9kaM)Yp}WycڍU|`uNy/c ܽM<]{}U_aU>rУq;dghI$Mq+MJITvLʟp1\BeY1̗wQ1 DVs&EeJ%Fz/7 [mk1 "^'{޶<Wg|)/V 8r)uTo>w㖖 z8%i'~}<o nzW*j!0[7qpG!cH}ţ1F/FaC,Q|YR5%QAi=P^~{ӿ/CmjPM; bI ^[nmuw`UmoG(z?n6_q/+E$RYuWu+v.׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{_'r|BRcT5y*MJ!&cΥVVEDQřUIuݛl.d o3Tb~@zh쌖wf6tsJI\GqǿQ9O9ginoj'_;Ͻ̼Q3j>KU :)r''r΍/a[@7Y c'{}u~׽O {'|.Z@?y~}Ky_u?+[(rOp+d>]s]Ryȿie}{޴~7:{^Bo [ݱI6bxQo.|V>hQI[}fPWsZ✻$n{>Ƒu;k>͈ K}:zvܹNv5Th~uM1FM"WlsRZl*Wޙz^H>({{u׺{^{{ρ?۳i*mN'1S0:IU6kT`n}%>9\MS/b9~x^sG,CTA =ΓX%^b E<'f{A CoQI'aUb<z[juyԻhl&?om5o /NigyY٘#xwn`{V9,ƃ UQ@U@ǵrͶrfE QD$,Ėf%$jdueV]}ʾoA+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{݃7OƎ}Cm>x0-~˷+hQdVxnTc٭Õu}y[rĆ9%-L I# 2;?1sV_Qw{l&%C`Ff MA᝿Zo1 kEn$B]_^go#>FL7Q_۟/m׽ܗx?tvJ}m-JGvv#Vk3uhN9w/r'-o-g7Dۄub0,|4+_t?by}kHm=Ѥi'ˤ)={{WY׽ߺ^~{ޠ,/.Qn^3vR.<KR.E[oS(50d.ݬo쭏s:IktV1;鎻qଆHmȋ1h䗺tv=J4k'qug9J帎E;CROgo#>FL&eŠ.폨/0e~vb?iltl/~{]^ L"vm}{؟=Uxn]W2=S[:p7$j|"F ϰ>=~GS~g}m#=w- \o$ĒJ6` HPNXH 밲$r:F]’ 0$O ^NS_̋yͼ3M._u zi,F)\67<}پ?ugڶKpYYEcv焉4댛Onyn$my\/igo#>FLeݗ +ܻs>B]_^,7CEu7vVO}:+Gۅ޹ lbD%vv/'g[A[nS痸v#=W/ =ZjI,= DS7'$<lO/^]ؔ U$ï{ܗz^~{߽uz4_6>U|]_in=n^,řt 7.孀2u1 /[6拭!e.a!6DCF 6>SbmmǨ(id"9nEH+A>\G|-7(En:oG|-7o}˷?c!}_.{GJГ%?`^Rw'ŸJI=2Cn_En5Jn93m~'*. o$񞢍ُw6e}@?t{H?]{||!toA:ybUAOກfRI^܅ydִ/D{-rV+<>~r$x?=T2O{}5dz,r}nuJ,9<{ ~'6.n9Ym{2{'ƨ?6Y%}=;g6>dzწ'6ΓwgG9% !>k޹n9FڃvV-ȶPzu.7%l㻸d\ vW^co,v)^:qμe!UV}ĐȠՔ4ZgSoxS̰lpl{P.HT,$!%W7-ϻ|4`HCFA^x;ommݝ}퍷`1x6*1`K$hrOnn{Ow9yfIdsŝܖf>kn߳M6l8E4QQP={{{߽ueV]}ʾoA+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺G+O{>_b7ViFӠWЧ|^'^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽usq,)fJ,:z*:'*y0غ9d],сXA +I+5WF*G ^M?c;?urG1W[־\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/)Vkd*}}4U5rUQDURUϒ j$d7VGF `N^S## je AQ9m9pE*2+)r H ׽Ľ{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽twO?1X_]- Xٝc9Z*ekg Kq,"Fu>{l?7gW/b]Y_GKCACIO䞪U(Y(׺~׽ߺD^ߙ/?:s6X{ bo\,9]o.[k}ՌcUәaA54ȗGR}{TYtWg^{ﷷv0{j[lnl>3pŁReyj 5K=O==D.M H>{~k>-6#/r#q]5 lv y 5FV8tUb ߽to';șI6^>{9]ɈcudY`5&(\CM{^{u׺{^{9_Ks߽u2?ԟ3`:^>v= ̻{ 7w]NMW%X_ 6y4y׺~׽ߺ^~{߽u~׽ߺZS=R?_{'gzt]O;,mm>odi˱NqQB%[~-~/|>.U1{3ɾj<lP!o2iOu{^{{u׺{^{{u|fdU:ⅺ-zٛGv>ˍwW?Az~j;AbXX˞{}ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u*/0w~;ۧ`u,"+0b.C'PaV %{=DUK44GQMQ $3C,edXPAR.9~}~ _?$"z>\F=͹vn"uGkQUJYa`8{S׺9fk|8kb#k|ȵ#%Z5l͕@ꠐB@~V{^ _nG~7oYO-E 3=_^y*FU>*7{~|^_"?/ru wa>/tV O%ܻ%bJfPT}-XߺFY_-h3 ]aW'rfRup>{{u׺{^{{uR|Vãs{u"O˛*}/׺V{u׺{^{wsg&.}Y}Cl ص{ktn 1B|`[/{c x}fwo^lOQ>RE2[}{g?'QK׺u׺{^{{u׺{^{{u׺{^{{um#;_Ի۵zgptwiwN򖋯 N;(_ {Wqn|N,5#}{I i_0N؟-7sflprv"U&Fc h={4~&U,1'G7l}*2cg7.cpVi9,|TGbeU@ {u[JG#W$#ISY[[Y1y$j*jgMٿ$u\2k6OMS ?8oZINȖnq*@EuNJ||U񖶷W];{M<<v5t*憇7"9a{^vj*% ybbRK,U#4RYs׺_|7+~H5TT}&R,lZkOڟeIoP~ҋ *~P}[}ٱM썓QOO"Iٌ1awLpJ:{u 8~J2CweT~هp <Xӟ~*m͈ٻ`ϭߔ8 &I{suA LQJ܎זx|sH׺<{]* zw{_pm:ڬVmuPJWܿpddS .dz"xGuQS!ݒjMPQW>S.WpiK.ae "ѵV=X[s~lI_?!|Y=&׳ro~|l3SF9SE@J|;%YifIߺU A|D_}A߿{^s=sm䥆jzmf4y-C|0gu[I"߽u߽tfh˯n|?vn՗mvǭf^/I K4HƊK{^~b>tω؟-A?bf7]?DuVhhگiTvyr2%f }bf׺/} |~G|qꪢzut;[+gj$ػ*\hYVu5~et 0]I<t`؊i3;ksajo n6 zYF#[ߺUݿJ'[z{Nw۸*niSXJ|Y,F kڑ-{^{ s})w=O]YM;g~Ηi>f}\j5=*1ȚAtC?΍?WI|͛ojev|4{"7^f(%GtEJ}oS̀<7fEu5"] t6{c?:vٿ03f:·av|4{#& ׸ǶbA(;)NX{^Y/ 'ߺ[ug𥯌_>[j|~ݸۗ:=-󣨭w)ȖI~ _c3lϕ}ޟڛ!vSM,pX9IQ5T@J=ߺU-?7^SlQٿ%Xʩ7 1;*v&}[!c+Uh#-~ {|b~H|o*zs;[)gjd؛joSi)}~noC|]gcKw$8-σj*i ,&s3.L)i&RFu~$-˴h6#=V;fmLu<$)<-[r/o7&jius~j𸍟E*Oy]ʹ!o=B8jva1r;\܁s~ςO#~Qu6YմؼNo,gk.BUwo-w˧ɊBVCߺFgž(-ߔ۟`t'zv[WanZ?/-wOݘꅏ4/(̤~7 :OKIm S;/U}xh~3 >^voo>u]ձj:=Mc\eCcDPM7u{^̾U/<>Lػoqlw lƾf W3HXs{uo:=?[OzkNww[n,OYM"l6Apae3˸#h"Eҍkߺ[)/viu/Ntrv_r>˛dKck7&?m%8mmřUY?U=ߺW׺–zڊn{>.ӻ./~.c-~')4PH~P6{%\2 _>{|!K$X2c%qk-ߏ{^|J=ڿ'zg~#V"]+Ϫ/#gW  UUuN؛c:|N닇7cw6xv#7FF(䤈2߽uV/'Gu,]gשٜ emE33]<%=ߺG?C[k0:;YQyv(^ bjٔwPc(#M%CDQuD= ymr 6=DQ> PU,,Qk [_cvgTT^l<2 #~/*~0v6mOf +Yvv ~F@-^X%*e8l`ҝBߺ[a^ػKzv׻;3y\.knm(Ueuc {ߺK~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~O򦒃W2XM^^Ë\U!C; Ha͚{ߺWkjUW~an}E4bENݦI yz4˴XG>{V=??yk~9}7BY4K  uQƷQSHf?~_E|~f| aW޺n˧cvl@@ Q=ߺ[Hݾ> )(uGϰs EvtUWvgyb {^9@橛+~ٴDu[׮0 {K=ۆ5_5N{'ʯݐW >oMrOoՂȈ!Z]$U)k{ߺ_\^3!؊*W/]IciQR€5U2"K3=ߺ_t߅_!gэJqFwZut|Y,xnͳ%J↪WPP{^ 0_Sߗ>{|zcu~w8wzs|vw+s1cuL3²vCy#dT FHS)uEg_?o|>nI[]sb*6fuv%A8ׇr2*T2L[>{ߺ[|,yO.~5ߐ|~ٶT?۪=1ۉ߽|xEI{i>ձ©?.3^{/{^׺B¼[D'׺ǧG|C<ߺZ3>{wU=u؛f*6fuz%CxLUTYL5n?!C1vOKQo{^aFm_7{&_7WQ՟&zq&JLOvu6:bfVf ɴAd8Ҡҫy ׻?u痥?cy)C[gUC2RqtR!}ߺ_;O|쿒m:ni1]Ӹ6,r=YjGD@ UL#F~ /qׇ|a:b9Oqm]s[uQEFW[ -Wr *#c)CTGQ>հewgG퟈?%Ѳ0InwwN3Ly%l'z ^ lZjcZ ={2]Wn\mzS]]D3lbJ*(fZ8bLQF~oc{u^gήCsӔݩJnz]c3_$.{=CxnUK5UE~}n  >{/1/ZߺEgH|翺w{M{}޽>?`-Ѻv_lnZ\uL_:iVT< xCEMaT&(Tv/eI8Aj Ր5H Yg<>֓.>,vocn&ܑcjdd36ޮzR)X`JȚHk~o{w\|uy\7Oɷӥ)*dwZnJv&7_):{ߺ^~{߽u~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~ցc_W}B'.(&K}w[Y~ky ˇc4{{7O!xܦڴ -^G{^d[~x>.oyߎ[:ou\V:Rj`4o{^g?_C|j܁Xߝu1>_s@%@!{^iWgwObcvu?p,1\s%]4!HN  #qǽuT ?[dz}?wV<^ .CF+ٸ{^~Zȟw:S:?$>CJO%J͞g}tr.T{^I+1lfIb ږ*`qۃ+1LZGT6 q~}ߺ_-OYbt~L}tM.nлwz㩢eޚE*OwN#ՒSF#ag>{O{^{?{^ XFÃnu|[~8m˲je|oH|~.Ra~S%gߍ$;{߽u~k ÃQ{uD{ǿ{^ o_@,{^-?_9ۓM]ߍPDM?1uK G%dF[5}{{^ ژ=Tcqm/R" j133|M#?q㢪ߕ}*gb9'߽uBکWI`r&c\T{.[}ߺ_F/Qje{+|8JiXLWvvO6I2׺u?wv>>n|iꌮmiHjoDAo͑kݵNunOu`{?=|C/nARFb;{Stko}3Gv 0Qt%$L)qwT=DHFb}{vSwE-^D> wnO 8cynEt:yT׺{utuώz7vwծz: {R#%]f?lct E]<-tߺ_?~ۣH>k#ۚlݟ:=הw/ՠڛ1Pv-T$>{1/Zߺ[? on(2j϶Iћ+"F8F[뱠F NvC1+zZTW ߏ~ X%*HfB9b62H?=ߺ[#Ž8ۻ9}Z1w~)Wj% ̢n࢑߀ߺV~cK֝egVTE}_{oAX,7Yc!u38~}ߺ_-OYbt~.쁥gc$NotYA|f2iv/6 u~{߽u~}v+㟈p|~֔.UuGMCI<@9. E~- @uu~~j DRQO[_ &F/Vvmk9c:*l4mc:׺H{uM2?1{+p{uKau{sKt~ּ?~78;}ߺ_a~3Sv?P{u{ʿfP_EPfʨ?)6O{^׺ׇOn9s ~|}ߺ_~o޿:'tY?~Gh_>{{^@?\/g߽u&_ߍGf~{}ֹNI=6Z7^~eY<_Pw'\v*}BxXǿ{^׺[%ߔ;[_ۻo'KRtn.h|?huw>O -m4RjTvub@rI<{^yDퟕ'zl6genxM'[G)qcw&:h\n+0) ~mc{u~|eA_ ھ{?=©.<".dzi~^{,J8?3O~Hݡ#*{x; WXo[{^e?D/GdS>2KROwSD{oz4* _{^q׺P5!V:Z:L~:95SC%:-h'߽u~}Qf/Y|I6?q>/uNWp*#0b3m|"cw q,M{^?K:?~o%?}G{^w~˓{o^R߽tT{"*u~{{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~oy`lװf>,k;w.*~a`7&. ,j[$m ׺K<ϐuyNnM,^#W]-l/-YIR{^f))ZD^VvZz**xQ( {^ oy/h3:sHUd5*eȩ YoJ:"ܧ{^}ߺ_m󋣡"+h<~!I7Y !6.Y {񩫪tH#i'xh㤣G$@{u_'ݙ AXW7'뭋fau;%FAuK~|?f}a߽tRξDƯ~ӳ߽u~߽uێ~#Cg}ߺD_Eji8WG%fޟe7%^2+,eغ쬃\ O~|ٜbYJ3aq|6cUv3+QKf?%&x]%TVV ~mkz;:WBMۻe|}],TyAwC)y_׺?./ݝ d]8Lٸj.Ml*kr/7碉Z!ˬ ,K&׺O~㩿U#7߽u߽to\.S?~ҳ߽u.swΏ׺ׇ/o#v3wO{^5׺wwo~ZU^Gm>^ᒠa]OkNR(pԻ&4d5ٚX*~hgdW?-1~ n:stw#!E?`osY\XoRee &uR}{VSێ~\gߺ_"_~߽ux䷯ O߽twZ?1W_Ͽ{^9׺9tG~k |Ã߽unڝ׻7*콙:y fvWmŊD9>JhZ߇>{4^>]v_>d2OO~Ts7PQM%n>1Nx*뀓~_ʳ|R[s}ԛ)#)2Ng)᠋wa$ep͟´_CR!(R)/{^ɾw²G},^}ńMޙ܂AYi"ʼo㎶4gWu=y8 .{z.ػk0X j1Yv)*(j*u1Q?ɿ=ߺ[{uJàpvVKY_|[ :6Hh+{{}|>u53S%Qwu:t8w7gnTM}PaUv/X_M^eEh{𿔇)k6Yߋo;m7k7wX=KScڃzTdx#E5~Vr$c_nޗM~Fl]A-nݽ=mc(2#[]&<3_׺|RQ >L|wl+qԵTsoqb"576z$YKuX඲:$o^ΤF{OHZ:-ղwO}4>nJtL}ߺZ8_nI0nֹ[tg{J]m"mУ N۫zm<7x}[!E4XW5蝽U"$Y]a.8lNidx斂*{^qE$QDqƪ(TDEQ@`=ߺ_ob_uC,=ߺ[u\zWu{"ޛߟW߽uۿz3w^zXu`inR5]W#~|V7Oe{pg7Wϙ5YO5SC?=Z릥hTXe<X* {u𙾽Wu);{Qnluk7d涧V ]8%^mw,kN%> UO{^`~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺZU~\Fw7R-c쭹rf=X c34O3nZdĎs! ߺD""\_/?A {^tp{i퍓hv]: bq4Q4߽t~k/ο1?Mywnu޻WdϷ.y<6Rc`-NvJ_>P:(- {ߺU@E|DwY{^qNۣͧsL+au>jou0׺{QތQ!Ȏ}1zͽ0;?7_4hk#g_Au~{߽uSe>{?M~uí77c^߼(X}[R XւtIOAhRޢ}ߺG߽uK3GsVUe&ۜmm3ur4l[},5uKU.Q[;$}{ֿ%6_F|%J.Ԣuà"8?e.c95F:sYS׺ J?/;|,#%6fmMǺфݿn{/Wݻ14y\emJ>B Cuk덋}g޳s.nRF,Yݜtl< jrI{^iSa185IQc)C G(߽uILS[򯱾HwWJ탳 mVK[:{ߺAkuO[[^N]en8-Áb,l̉,N:ߺZP|Ltym靫;{W0KS!}[+<0|tdq:5l{Ew{7'U.Jm>{'Mɾví77\m^Ю5߳Y }[_5kO/IXb=ߺZ_?5>G_C׺ݷ߽u'D|~h+r+qu썙%ڻ+ol=EQEI[VvZSXRt8~ WO2}T}uPb(.?s&F]O DoQXJhb~{~ROHEsJ?˗]c-K}_Ok5׺"z|韘wv]mlJ }׻j#W# Pj#0&XI>{ߺD3S\t}A5MvյvzllTQ6cbV7tZ1%=jDE< }{dw"&[pO(~XlͿQ;L6Z~ѣ3RPfvib,_qLGI׺_ X_wa{ciuNk7Cf/om>JYhM/@ѩp!ʯVJ5w~~L*(دM׻OqPL ) ΢׺9LO@YL.R~_;)[daza:nPngWvN禟kCE_Yժߺ[N{uatSiGĎuU9L蘰MכnKeG|~jg׺!ϱʼ{k쌆 uyύ>U 7>urh8U(o׺=?:?ܿ,~IvV g?,U>7r͎9qKlfsPkQt~m]+ԟ:ktFuꎮTvJ-#PK[_W+UTdI%wvu~֥?2?$_>e|o{\_:4eNJ礀%u[@'έOq=oݻrw {r;qU0c۰ Fi`=ߺW׺7r:ۿ&;3GnuN۝?:z p7)}ӾwU>^j4ի3D \{^wtW~Hu^{s~`v~/EܛﭷFnoCZ*j޵S!#P_~g*/_׻0뿎zD,K3:ϯ4Rҿv/ߺ_-υ7Oߖ>,l﹋5}6XD9\'vb*~ӆ+QkAF}{v[v.]l[scl +IOGU<|v' (?Ԡ~+=ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽t@?mY=;ch[7ozVl׀Uac{uww-C,si*igX0߽uq d1xṋr斣}@*SػE8y]M KP_ug;fT?ˍE)X*wmMk#iZ/Gbr' c ĵue*'xE1՘||.ݣCSN5B6M~RU)^**dH`H{)]N쌾^H([٘g?b.Uб%ECGi{ߺ_Qo~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~|@q-SכOJwIo|=-ǟTnU^?nz(jrxJVVdh׺_]E7&e=E=R=P;XM.}{d𭟘5wt/AFqۛ7Nmö20=Snv {b6~?C4W}d'G_fQ7u/Ktj|M=%ڝ({jesYz!UnPQQWYQ$T4IQQ$P$~}g,ρ]%R ~kz`1øN1_Opz2 4Xl5Cņ$QM&#JeE_{^ʽߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽uH?Ο2㶯Bllɽi;\`&[pBLڃKQf3 P}{k07ZQo.۝vg~{zCoZlu͓Ĥ(ÖUOuG{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽twEuOɾ^[}o wU,3Fro%cONRUA~6fgn.+Sٜl+r4%xаgP}{k߽u~׽ߺ^~QO$.qؙGju =lnW9I0ԘM١@Spֿk埭 , ^ꄓ?MO#"mPǑ}{W:[%Vu@ʼ"ܻ{r9[Hؗ۟{^h?,\E\zj38=׾|w& 1GRAόRqS r3JߺVo׺{^{{u׺{^{{u׺{^{{u׺`;kllGu]˷~}ɺs8C5D4ˑei11KUQJȡuQߺ@w9*~7=ߺF& :"9iex pJA{^?{^{{u׺{^{{u׺^~׽ߺ^~{߽uG(/|O=]]ۻ%K%Y>GKm}χƶ*į M<Ļ.O{^g+ʿ?~4gO {vSewnˬu|i|iܦ#|W`MO+Y}{}ߺ]3*+30UPY 169>{_f־Y#qqgs1[vcvo5Yڏl}.ezRPO! 0FWm`={{ _m~16~4[-oXUsdqy*?Qa^yiKWR2{^OsC$sC4i,R$R"HBUu ~?~֌?kϿz'@N 7_ax򻥶NoZbonn25XE׺/OwQj>Mn~:2d7>߲ntɚ--BJ#Nui${u^vh濷p;wķĞl^;jm$ME u0@ {uFOhvfb#ӱ7)ݕѻ;ӡҲ LB H$/f ߺ_J/~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ_.OY{H:O~҃SoMP׺}u׺{^7;?7h|.=;$Q`n}۪+m rt{ )4RHu/ZW߿vFӬZtnjijsiy,lw*ɩJ~߽u~׽ߺ^~{߽u~׽ߺ^~|l[?[#}=Ka|#|ۇJWQSӬbͭs׺OKpv?p[r0?" 7⪚glS5N;#B!d:$@׺u׺{^{{u׺R+{ǫߺ_o~c.?֟}ߺC{^{{u׺{^{{u׺^~׽ߺ^~{߽u,;/cVxY]^Zz^T1"Q>ܬ ?SzAeu^ywXo{JwW^o vhG6j?2?>KA=ߺ_xݝC}ʹ^}fQ"$lbVA2: {~Kj}pVoNǶ+v^ !˾3^m׺:|^bito7]72Fg$jar=ߺM5fFz:6gx6GRV~WD|fb髿O.n܇k7_;r$4id RK!H'߽t&mݛ^\ 6|Nr"J*g>{gN g;ø+I){yfwdd Fo*} {u?AuGٽ9APw/Q ׺t~ğu>{{u׺{^{{u׺{^>u)߁?̣-#Sۙ>n\VwFwT YoPT`)5bx@׺>(!oWvO:>ڻ^cAcf;{}v3tQb2#)"up^{{u׺{^{{unJ^~߽u2 x_~׺{^{{u׺{^{{u^~׽ߺ^~{߽tTttsZȩ䓻3z -QA;ugvF '$ (fOufJ#ꨫi&zzJ%Uydt`XEǿ{^ ?h5mwN*Bw^G&61zҷ(^a:׺~fS|_}۽A$D{ f']eLTu+{wQCC7MvvؠXpQlɳijL~ߔ}1rn{^}OFJWyrFo7dhg0 MJ- k{^@?"?eO97-ww_QT1⭗/y|gPK.1؜&R$i{^mv{}ͱ6>\[ v*yYÒb1̵ _o~ݣ?I`~5|tcz:41#k&AԀQ8NH|%߻; tn6^۸M=#.ܙuj ^^*fX*e6{^o׺=Tr;_~|GYuZOg7=)*dldPgq=*}y%-/= M-Gu#>Bvwo]jspU;3Lr%-C],I&uj…Wm.C1hxw*mcztnITI(J1mTCVt>oϯ]{>g {[rϰ;Wbg'\nlVm #e׺ޏI'L-~#{;|>hvfo-[kcZnQ緎W1e31R站CHߺWK7@|9eyI'sczJڭoջymMAapu4 W IN]Rh_{^#c6#stҔ+]=xpLI4TN $~d~TAOwEwie+WUv4t_S8̲IEuGM~n>{^vC{OvgTP2ao+F|2⿆;juG_{^^6R>YՔWAw>>#OoUiػPؙRQE$E<~g__- v&l>|7xm\~sM׶~vۙT<.{X禨$~||{u׺oC [u՟>^-so|zvQw݁tEP!hwVhڮJbuߛ=.޽tTNjܛMR]eeUy 'fbK ~{V_?Ӵv>+v\atoj̖4qWdzs_|E+I5-=TxJɉJWԳC~}m:vzg\OWgO[w t37=Hji*1їEYa{={߽u~׽ߺZj©׹>4I v6>tvWm}æ'Tƽ\;,dRVTvP={7̯?V.V7}oDŋCSQ1:b] Wpx~m-S):/vE0|ǽ3XU[!6N*-ebN$Aj4hɧ45~~*yc IYaT5| {]aY: 놤g(^khehuw6*G{^?(Onog0;ѝݣvbu2쯸MݜX=3ojk3-NY'{^>l:QyfqmUu2b[6:omc.*fm*nҿ;6[*%SuZ|5;yu~-GRaڙuGkz&ryY!~я9 Y|/nwUz~6vXF{6 _]&cLM {9E#tV|%EULpov[ܘ8{l | TSꧪ"׺w7/"wnOje=sSX1ٙ1l|!KI FG{ߺCo>,Fx*kzrn]Og^uM PSCI L׺7l_ 7ܛ|a>)lMPf6co/͒>I壒JN*={T{"*u~{{u׺ԇ}n^;߽u4E?`W~}}ߺ^~{߽uo}Jl'Wu~oM[;=KTUci7TyJ:ad奨 ~|~N51GuW;y_5 3;;U)XUy;ì@*a~!s8~Lt^/f;۴1?E1y<_3^>{?/*/Sf/YfϏ'!}-=t[ML{?$ 9 $ QUՈo{^EGYGc+頬*::zjJᨦ{^EX_' >>P-u;}.纲=Negf*1Pj B{1}.gxa]g6{C'k͕ syr_s!&+52#,{ߺ_Q_~֏S;{hwș1z??bb񝛷q[WpmEatun:zHFV7O{^f?G*1=M|o~)&~-rA8Ms\КM&&iunJ^~߽u=E.=wvw&`;x]"&o2d\bŚ,L1DM~k;q>]ۙ%Atf'yewlF|vf|Tb]Wߺ[&R˿DZznoߑ .kgf:{εyj=mʚm] RCI -SBߺ_VlN[c3L[ e\uDU3#MeBx*i&I"׺p~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~ |ee;|<Q6zv$YAmQP8GǺ\'߽u"?l?5ݽmgZMFw~;85mcR/m"j_ 1Q\`vz.vyTGӕ 2G\kH߽t(?|k!]E8ތdGxwy8*kU|59S׺E~> ?mҋmђgC[^&0I(ЏUmozn~* 0EI&;or5 p1cQ׺[?ȏ*yjy?vM;Ev-A4>.OߺZq>3?~`+}xd>Fn?444Nj)%5of`h7Iu^{',?P:k{n~ y/_Q=ߺ[…>a>)]a;+~`ֹ:Yږ'UG; |VXE{ߺ_/~$ώ?˫T]ԛ3w;;^ܛO[f}K>\e3 4ݿƏuvW6-ٌC/o})?hi9޻yҋ/yvb/{^E0,-ESk<}d/OYAJZ*$ $412:0YH<~kn_߽u~u6?+z/-by*h+0[HafhwUv@o׺!?\o G?Gq }v3=DUȝǖڑ2+=ރ 0pXߺVuAO56n %\/Y#WHfsC:jVVX\׺x¹~ |z~k؛%66TͿKV#/UMMP͐+橙׺UW:m~;;Fظ3.h0 ߺ[6/u,{7{^ ;KEɾNuٛr7m]a競_9*1U{r6B *y_Az'Gu|mL:}MԛӦ= p5-⧑i멖JJ楚X_׺g-9G csMVMA]NHjea׺Q;S5{1YʹkNPpXjI0ӡ:ZxzT{u@~{߽u~SN7}uɿmݕ;/߹ ${) m-e=K7 ՃHE:7z.2(ҏiuۻnSO;oi~ I,Ē}ߺEO?>z|z#nm`3H;Ǭ&Foշ-p5*e5XZi%{9 wF4[7rOLJf`rU8Ƨ/TRB@uҿSs]>㭛'c5d)[3Tm6w<1uI|ڿߺZ|8ɼ~f?xw?z~\WK1cpnX9jqGnW;H}D{u /ӻo8t-&;rozͿvWe#Xr[ ٬t֎SAOKPG~i5 "\=ґ|ts1;ptyc^n$۵[߯wLE5. .7n穲?6J423u7]#<~':۰Ks;Ƕc=n,kuHE{^1]ѽFomedd]ٛTlWg0D,SƑUPu$9N,&3֛cw;e|f Cv~ 64x*=0VbL,ST>/?/E]w*q|v5r@tC93!ᚒU1O,/~|ggm~h|3> ټ}`tsWMN"O;zu"ޛߟW߽u~{߽u~֤?uWuߐ{H/IzO{^S׺{^C!Edachr#*glOA>{ y>x|wV۝j$v]q {B*},v݉u?->tm׻st;S1{qh^m$_k6ekiɲbYd׺C^U>Cu펮ޘvwi\3Xa-vp_-JZz YUW/Gί!YjfpO/uZM|(i/9mEXDBG 鷿{^ vk_V-ە7>6n]wpdfijjqq9M-%]ILe4eɻ={wq5?o#{^?+?o#{ < >HM.SzO}o KZY|^k&_|ex>ïs]7&;1;vg2ۗr2Ves;_Q2u!I<1,9c~}81CJ7_]GMRvzl5W[,^n70fqĕt0Ȑ+Tߺ[ZJn[C1[[A;#p}yץxwQ#iA_j'H_׺|mo?woo>M{`d6FmRb6'6+YH%4$Ou!-??~?rW0:W{u8{&+}OQziv_ɯ8*nع=ۚ4?\Aٚj fޛoÜEW}J*"cS~ZZw }]_zwb?gm]}Ct`0{r=S\^[-,ԕ&AAM,^Ƌ߽ux@O᫖)Gєvsfj>1M≮vb]߽up{{u׺{^{{^~׽ߺ^~{߽u~{_^bqRvoYUhUnޛ:|L{ y(b~]M4{|A36ew>Ijt&bI$Jj01vҎHɳTW^P@,$ ׺KJ߼K=yE&٘Mh_HfA{^rFm;r>#5p^ìR=O=@Kb}{-@^ C9"9:;`wN`s@%}v:MuP}{-= ?pqwMoᷗlGgRT18^Ī.?ro LB$t~X,#G\l Tl7ޅ^O%4[}GM^o%$MH ߽ueul0b-Biw {voiQJ(bRo׺{uXO{@{߽t/(%G~^-J%xiZT֑e{gof__cѧӦ߽uYZ۪õg~Zgpy5Fߡ~ck1q}SHɐ"drRUWRQ}{ߺ_07ٿ)%Or='Y\ϟ)T؍I*JjY2)NZQ4/ox7lb8_poN$sRjv.8Cr @~oԨO7MU먠쮨FC1n$Fy:_xc}ǜ|9t{ߺWSߗ{gbY2P׺{uGm\dU|A,q+d7nSM#9}ߺV׺A|8>P% =1DH=Ĉ6U{uOs?-v~m=׺{^{7N+#8ٽa>?Gn 7lV)rX-pfԧ'礦XuW뽃Pljo?6wTF+ܝCԧwn՗JN2>1~|w%dc_g8?#>(U79G/y vr7{usrܾ{in Um|Wn蒦)2J*Tii$R}{g'1BYn%H`;{Qu ~j }%?{u濝j̄ _o#_??/~؋_cb _~^IDcZ-]^1n\>{{^ Ӧ%_q`"sT *Sgk f-1S?"MW߽uu~{O,:Iߚ SInMm'S3u5|axuEO7?@;O+⯿{^׺{^{Hg?!}ߺ_3N_x~ާ߽u~^Y|,}™1Cw1-"UF힀U$a D׺T{uGjcv-El-;kRmjlu4;~mS JBiJ:ӄ}ߺJ?O\ߺ@>2[˰z6Hsym>*h(it'%We+6xR5*~}k}wvς:uVm窛ruN#)UC^FХI5UAu./f;z>~S%gߍ$;{߽u*.%M~m5C!M\ڟ ZA>)r_߽u~}> wik_MJT6DK1(J;ǢiߺF߽u?;iy4z_u快ɫW{ kg?qQu.!ے{׿z߽u~}>'mvh?DOPP#T ߽t#NҦG\x%clpCR(S; ֔TyYLN$jU#׺f|NL?GbJްDvnjP$QKZ%4VG~#ô}=ݛ};y s}2۷*ZŠk]׺A'+)5̾7f~v^<`Ҳ xw+1߽tv?٠T?; Yz6䞷xMCH,J7.å5KO{^~w߻^dnl۵}T9ݵ+K+jQFO߽tbv||cNJ;|oFdS-]*j#fyІΧKk{^} op5~?~ W~Kn{/,[Q?v?>^{',?P:k{n~ y/_Q=ߺ[kž~/>O'PmLdٍй S lwW'P ibp Xa׺u{՛~4g7o86-Gۛ+SM6zjX B%ZjX$^??˱s=w_,bz3NzeFzMwnUTmy '_^;R4 ߺ_\K!Օ9V%VL 䪬BOSUQ+;Iu_uWsv{~iۯtdDl쌵qMc'ضCuwvG3T5oQLmK׺jhܟ̗]ٮ9܂!ۋgCZ?wyUL&t:6_h~ٺwl؛Xz8~j }%?{ugoF!?_~߽֯u-[eY߽uY_?C~}=ݱә`g7Y|x[""TI*M{ghu. T=uM{/;_7:Mj-2H׺3<_Yf'9(^ߙz(6J{~es9 (qiG׺S{o#7ow&]k[ WJ|>MRVTF+0z"WD>ū_-I|(6VԘNe]ꭁl]khuḪgomry dgH5;u{SoMP׺}u׺{^RYx:|_~̿'zh+bQQ<A,K!X(Գ3 ~ܻ/rd~{ec_^߽t^w}ݣTEbLg[or'3Pդ&]_/~|:~Y|r>LwNƤ۳rrTS0Sr-msF'C*'E%X~ӋԺ>7 fʤ)s;r5[oES"˟vdtxlt4!i={}ߺE?? 6 Of|-ɼsßrR/gPn,E mQPO~ Q{W:{bU;u]}꭫;t}GU͈B<׺ 3Sv?P{uoj? ׺h6?oooBM؝"lcߝs?oXO& }{KR cq4׺'v|&}{SrAM$Qc{qd7،a#aRQl"4߽u!-??~?rW0:W{u8{ǯ]?u2/2^{?{^3 wMW{^ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~M]CAtort6@O:rlamLʺ+Yy9~~Wmޝw6 vn=ٙlf/r% P~ ~'0>/[,gqSzl^wNFZQizg(XG{^QC 541SAi0C (UU,=ߺXh5̍,%E }Tk55e\/OUKQ QH>{7ۺ. bNmFZ)dJL.fVe)U u]ڽg[_dSvg\mQ+N3qv Ƒ2H-{WTήnٔe`tZQ~ml}*]1~,n=ߺK~ˏ#7Fk>Ncpq2o^gKM,BDW߽t.-615YSKvFS$"’c(7߽u}~#/AGe([tgke+ԝYs i؍ق@~jayji$UGSM~| om;Ӯrfh7_VN"eJl.e6jjgUu!R u4_9(>R|2w_|7hwbUoY-wkⲹ @E*aA됀5{^0?7ݟ{y|q%;缫M#n\WKH';[5fg}r4UY䞆A-,Vi{ ';Cf6Rn~my 6NKՃs$o=E4Pn H{uj]2ZJH& 'o0A jK40UU_߽u/Gxgߺ_kMSE%e'$UG7*lmco~{{uSSIW5TPOSMQOOQO:4SA<2G43FYXe$o~ɓ{>I/NNnݝgtgrf=nGUSW_v/f[Fo3!d*ז?{^꓾<|&'?}Pa:ٺ Lgna,B("TI)iV~դ|\/wݝ;zM&Bw'hZu_zgn⌥K⎥5CH^?{^꽾|Pk6ruN|ɲ8_!Q׻W+bWeRi-Bߺ_QKmt#+E]mȌu.Fz:79 14k/1O㕱~ֵ𶝷# Kfim<7̚N~Y(k6J*vv6?C?"\7)s(L>b}]hij{wjySip=ԽvX2 vV@d1,T~ vv7]t<5uM4,}ߺC?kTu6?:uSjFß;8U R4~S'9θ ״uR,{Dz0I!:kwYSR"~ڃg]nq3;~uo~퇊)+wlڻgrcck1s8ɢM,׺7w0YSlKPج]vA`i7QfaH k׺KNݸy&)65fC IQQK(d­Ȼ'߽u~|@?N/a|[>}onŷzML=?vm}ՐZڭL)LU$OA~i1>8|m>N}gjZ:{}ORѽMW|-ۙݓ9 _6wbboq3wEjZGWԡ|o'ucTմuUUCE-U4MSO2 !xc`Jo~79? Zl SmLʍŴހ,Szw^zM.ڂYkp]ke\G!\05%3Y<0u񩮭d5Sd2UյRUr5U3ZIFwv%'~{S='A[{>~v7q|ʨZ^ϸm-m,TQi:`aPUtuz{zGJ%./vNi% $x(.3'M j* uKtMPc:Ϫq65TcsZ\߽t&{u׺{^{{u׺{^{{u׺{^{7qV{|zX3ҝkܯV_j;]g5Ajeի߽t`)))h)ihi訨iibH*"-׺׺{^{{u׺{^{{u׺{'娆/{V%zeo [>),Q-͕H{^7U&.\'T_wI&uۛ/3 mn6GX% ׺=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽tɸvt`k%vqbh3xSuZnJAB=ߺE_ )Š{j /8~?u4y ga'ަZac}W׺28\m)0w#pL^2+RPP-z흁+ kGKm4&Kɏ,87?cH{OvGuNK=Xc7 =JBd9\`pCT?O~qxwݣ"3gwiFo+Sl5{^h? hmwXw(yy69[ ?Ns;ODS̲SW5^OalMg]N=0[/em<*Qav8l6Mb$҈>{g{^{{u׺{^{{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺAV螐}7['#%hpCz̮"0q׺Wmm65 쭣6~13cYXbi)).cu{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{xtQuo\Ao w,i&c+d^~8m랽Xv;ƙWn L-.߽t~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^w_'3uznߴʜe`,=S+k&-ouݳvۻUY'Yŵs! (ҕϬo{msvmy~4wB4D`׽Oe3܆ܹ֛_IPd1;3M.5EYs)Rmc:}~iwڭkeF0D%2kʮFA}m/m{ܷ(EUx#5hGm2jJ)SuOxb$,HH_YH#R`#]nN {I}Eѽ:bgm#'05X7ZX8%e!{_nt~JDMw$,:IU]#[\\|uX:5V**zMҸ#z3v]MQ'RCXM$JpE}篼{폵ϻuW7m"G&DJ1^(ue~r%^Ioi\H—@#w&LvZ|;UܻWw 1 L{S^f2J4j477vG5{\<~ef3$-JϟY=S^qo!Õ"Tj8A=s{xvF5{3{RjJ-VSVSO5UC"Te(tzW2{윭c \3N+ Z=*# Es^n=`޷~c`U#`IJj:5S^R~|\۟Cckn|mMS3ȼY皝"ShR<ngk[䗓bXjMsO׶;w^n׹whJ\T(^){k_+_cGefh'B2CI_ MT<њZjXdFeiaR/'w=-_r  _R*$#  #!ϱwk{+kW 5\k 7`(RDR ,|;{|KGnSZ,P,5IG )=2Z_{qtϵ.Y׵'X9[n<ž]S,DTW#g{"?#FtO{Okcl?˹7./ß5%|aWS]~DoWK#g7kAwÛF/Aa S 1`6#Ɋ8d*qKzTK75&mRoۿB0S5̩ z$ g 3J-]t/0f;%W%QIVuco_ו紩v]WgCvٜt`FBl8*̍1;gq"FV{uo/,2im3*=<4|:Yhn_scc@!LR[WJunvVcܝn Z?.7):--dz\T\\}=-{)NvdC,fe9W>տ;6es"KA^{_Oޕ;vjlCfN*%2}ĿRX[<>{ϞI;[6{<)ک#wO{ijx.Pݿz[B} Z^n׺{^{{u׺{^{{u-uv;sl:o FڢVK_.o#G"$pe)bK_|liI\E"D`W KkK}۽9wl¨ŌCki^oH_r~~q[ ?@o~r]{NJtP{G鍙7NϬڛ?snZjJ.Jz) 48aJPWsKcoov[TK*XUPEݟaxsyml) 16p hJ4֎׽ߺ^~{߽u~׽ߺ^~{߽u~׽n^0>DP}[g䩢[쭥U1,YLVGqIEQ#P g?l.vefrik[HC"ᢧww=`$PsqKhtyJVJyd1׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮȎ?Sڻ^Zu]Y h_S.W%&2IZD>=~ck*֗mQ˩5~ĪV{k$S<7ӳRnrI?Qs ˆ{zf|etMO[ckڋ!AWQȄ]]H>!ܶ Iju#YH`GA]Xn2X^^A1DaFGF2 ":?GOBurpuݏ{JkX_?Wpw_WC$>{Kma(Q;1=tSõ^{{(Yw#K4;>d<B׽>J|,o؛K;r͛)3ͻKjPaj(g;!q01O/m>r^dݴQM,FWVp"B C0~{vZ[n3Colq@D *,A$3Pu T=K|}yYvnCiϓ+<;>B Fb ne۽gh9f}˙G$8 Y>:oח]ۜ7 ^y h(S.RD*={'{ubOW&o|W=oBK%\{T<~.uWsvY[_z7~̠צ%u}ci+5K"Ps.zEٷkwtH lQxutI4F}z~T>MnqvYvwK[uv ^G|S *ITSE$37y| c)bt2I2AGoq:Kܬ) zA:w>chAܯH #{/l6_qe /!f1x|>&!dJj,~>9j+j$X5gw`$/+qo6Id`ƈ ; f$$.,-i# 3P $uwo&PvH TCS{†9:nۻ~)S"~n }mX&*g2-wi,g~o0_w0l"!$Q)pm$׽?; S~}\y(.:-þR4*>K'rۜڭApʕNG8 dz|(s79.9S,+S nSQ5_VQQoL^v^鶪go޲R,2+IOYCY0<027+O.ŷ7*nlWI)j tp s.or2mr6ϦHe9R9e.l-mw1̐1pc$i"uO:)^f۹gvn.,<*^Y Ck„|7}鷻~*(yN.sU5 /Jz#ʺoc{^|]mI,N4:P`u0{i>s9#b獿-BÚHNI}{۟Əxo݂M]SRv3nMḱI >W`bqj̅=D2Ȱ^9]/Om-ƊfJ[BAhZ匝2tFKVESܿA2D\L%[p%Ge!h*ן vuo/ý'͇biWky7;=5,UK4J%Ny w-9F~_K%ԭݲ3/„#Ru=:rwr3þ<]geQS்p]D !%edfGR+XA} 0 A ׽O?;߿.7dI/T4Xmۺy})zzhޒ\.&iJF#{]^V[9q-"GoU`$e!q+ '[l|PPR;~NoovO,ۋȣ?jo-, {{GKk@g:k#^Z^ړl菷={gIv_ǎuWmm9$<#LRep(=p6(dGEG!s*w8rf{:XhCFaUec\1_5k[U$2RHU^7VSN у{L-{؟;wOf߉}QPa79I9i1%3AOpQy?ۖ}X9h;+];,#,1\T%L4w'0C3̶wvS#%W ,%"H/iΪٽ:&&VItBJV8Ako9o0y<t}0 "qJ B{~NglFڷAeܮOk_QO>X=wmߚ ޛrwTnͱzEG];kbwM=YxOMMXi] [Y~]i=b]lR`ݗP>Y,3J\}o?eymٮYpi$ qZLuf O쟆@Oc[&RdVn'S Y% S!\cK ~}}9[.vnICpRxI &5+D%|AO,9Q^n9J@5\RAz_q]Æ[Cܻp)8,%d$SQPP%EMDlT_>vݶlwM&YpƊ*y3fn{Nc-q HK#UUO{t儣kޛ:X%Ofna04e`U`@eݹwu7ݺ[MB*taA"RT}>+N]vf3rLNk+fZӊiQ:Fx+NLyJm;$/ Y% 9P0O 0}׹nT潫ؤ+1hB8I;`llN;=b;+Rwnݯl]%jvZ8c SZ-6Ǚ+nO"L.;$*AƒRs6nVo{d׌C5ԱH<M7@4`E@>]{8c!:|[7٭J2r ~Ai*kI@{'܃yo=9w=Wna+Kxs+j*hz0oܳ˛߹ DIX"e}-AQZg{ש?~noVۃO#DձabclroIO!xO U{KPScr<{Ϝ˱rPcS]GiYw׈x#>"xRQ{ٜ\.o):lm]PW.No$JAAIvO#tЫK#,h"l>{5w;.\N 4X+ȱEp\ȩYnn+g "YIEX"fv$P]PO^%wo/[.LkqzM>W6Ư4ۗxmݤQo̎砪cmmO(VIgߏfg݋M6wݠ-QCZP{=ݽyxy6c&k!nec˪jLVh͡ޛk6o OKbVNmqSQySI{g}y/qXHV6q@7jck>#seL9VufRNLej'o.xw6ڽv_Kr n8\G6 S%BӤfGd%OH7)'",_^C#Ƒ4HB$jDvS(zh>{8_0˳:,")wH 1Z{tYd:2:S+n-ZE+0e%j8zOG7zn^; 6=VT:ܻ)ڞjR5Fa%}GB6g;'W%6w׫;, FNjXʊy\u?t_#e՝B8UvBN |zbG^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮU+2~I|Zݹ/~׆P,|TER!6"皬\17OcwfF^Xb4iy1Ox=vٺj8KA\EQC_{._' 1 Ճ-#|HĢdR׹ܡ u9y?CQo:yODw>mVvMZ;䧉_!Q,׽E?~R޿2_}\trҚ8zAƏ>+?>]sWi/?m絿Ľ{_"ǭaNp?{fu3Cv )b)ֻSIͩ6OlwrNhKiy[D(^y#Or6 du_po~]{?rfB~UWwjjpz sj{#?,> Am]{ò(l(&fv*^7vb (csYkvcvwxk_ܭ wI∲kX5TW=ڽma_4C:N.I$ )A :Wn\_>;o-o.[in*o曱:?dc4NK!?[v\tY,~ާ'mmIEFF35I9hXeHCfeGĂ4f!O Q$21F?z vKmÙ٢͝VtJ Ap#3G* E =7/[?c{ SF{vV3GO̢`m貰4FMNd;r:Oܟzvv6;}SY\F&n d4<0q;9}hݶͻxdWp:qwP0p5)~%<:tsuYÙYb%6⎚]0uTgz:-Ӷ񠖪aMMWCNijN~ s y脶o;kx~17痿t o6t=kW sm* ~3${H==!{{دɿ4:w;1Uj?[пgW'[|ۗm=KKҮ<}oᔹ-DžIyD-=柼>n{5`?wKq2A(WJ) 顧Yg.{n[t~c-D FYu Zd?;EzC2;MuWa}k_ު]o{Y/?o#I. ?}Mn|]t17BŀU$RA|?tnI =;ZO`ᨹ% @$^M-w?h|n51,g.Kwa-RSEIO"ܬ9 *}?1m<^tA+^42Cӌm2#Ƅu}-ϙܭImm**YĢb1ƄpYd{ؽptec>8ta7rvNAI.zav tZ(H9D7yni][BeTZB$nLj#vevd1~?xnc됷3c'|Ͼ;G15̉oT>Dx*I% >R7}/w=u[F 1 ,$btv`5M%H{<c#zm9&9$I{rJZ2 WT^b}z{_stͰoVd#]*L~oK{e]h8 È9|;<|g{i[?YuGn]utS܇^NWuQŤeGmǶ*1]\{|qrt-GhX U0U:K31V%7/[{|v]r7[&O;%OIt,,u *Hѳ- ԧH=vs˚o`}AYqJtտuyZI讣J$oY k/lm"ڙd_XDf{Gn}[O }weKnViԴ)[d7߿}.|V~6O4Zr[;(ΈTt}ng7]_mlHIJOjJ)O^?;?)Qn՗r&- Q׉j7\@M:εţW{iVI LJ&,~o>{ysr_3\mw3iVo[Ҕ^I ;#|ؽ+vܝ%n,Rc j qºPzczܿ_urc]q1Bjj$;ze{߼O s12]W;&Y^~ր "*u{=?"Lu{5g߇O׽_oT;?O_( SD>*l677r@:̼9$M2G 51+țҭFxQ,J$ƨʺ7|s{q[E]_IEbI&8$ǥٕJ?S3^=v^6ܫM>ڻWC.v("aPCVj$X)"Lm>{qGnQI. Pٝcr"$RìJ= ѬPGg+;>m&A FG.Y5sVUǏoda|iwܴu+iHMY'UzSbɲ+acCrcd{UcQ,2p Hs{vvʻ\02A(ve] x阂HUƏ-daa7c vOV.SYd1UǡO;ߛl4T=&*qSaa Z3qMr>{n-3ՠ sB,G.d @kmewvKbka,"KBqsO\̖߸]D;<3Y[#'y*>GΏf6YomJPGF "Dͷ+1>'^?w~^R 5>GxsWi;}m=V%=xB/Jy[rwă=#뢟}q? z| ?{O#?_߷/Kou]?rWԾPU&a;~>ڟf?{QhPu_v?isu{- /%>ń_||<_}H~_9 ?ϯ{oj+{?4 P7ޙo?:/~=_K_+>pt:M:iӬRmgu G_[OjuW|=U)׽W7Ǭ?n.ClTS,JH ɵE1XjjiihUXTSUT_w{WKu],ѴT2,TS {i7~o2[k#EhWdֱ )!V$H=Ľ2})6d_o}ո^kC|}vnvuhB.]tmg~>mfӔ9_oc%35k^yՖ;#ډ]VO5bGOeOZm_ig~Sܭ}:ˮkK/#@k_u򏹜w(s-Ņ_Y4+RE)zϊrowg7fܛ9Y̮s-qy JQ}]l#iU]Mo{.װ{O/IoYĵQȈRM@=wڽq ui[idjjydGw4Uh,ez{xo=.[n++2qޓ%C g}9O"|^sGkA"4oMNùp')7suח, IKdJ@{]Ux{:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮ9;[ug7NޛS%QKjV Sa;'WBH+䥬G A>rüZM.Z4mRƒ!2\c?77뉢x;{: ӿ-M? *߸:vl$,|Pnz9iݬUa*q~"?t/Keݲ?mw#K V;9׉>$~wwwsVed' NbaD?)? _j/ma9OsMs={ޠG}9Jzݗb^cd/ĩן-pH;_S>)sKKO^ou^kONĽ3KOR?ISs-vu=m}z_?+V{)+h맢!aY5s vۧ$W6F)>q&V8=j Hwu]3^ w?_BjXۊwVϩgܔS7sܼ*9Ÿ^U}(gwەndX~oU|)C)^`),F~ [Gh*(z4^׽bOW&o|W=oBK%\{H‚?}O"yog_ݵN/]'OWFCCt`W^'z+:7:9ULYD;CT:݋RE3 Paoyo;3ګyx2hG :m&xq0-OqϽ Q5U{K-x,U6b# v91XcǼmwb'_ޛ.q׸%čuqIOD}Y=ݻX$oN"?Ă8݇ʇϯ{)o7jTT콳ژf+Ik+MO<1F=r(3'ޗ6O uCyOa&PqfF#w=OQWϖoޯo-l!f70Y311`.,^޸!{6vކF]UY:}ޕi7.6l~{[a>ܥ}mmb? f[U$VkZuO6i{ wqio?w V+׽OD-J)h%!XH,I POr܏o*|6A+u)# uC<o]I&?{_=b?j+iftb%Jn>ؖLܪq䅅m~m_ UiŸC}:=ŧq4Ec2 H,>ZuTvW \?l|J}cʙ#hWmXw&cs<%ED7&>0u4}H@o(歺vǓ-V!AD0G4_O+p>\=ee@I D*1RÈ={PW]vw-Wi{)Ow/Vv|Is歟۬ﺇ#JӮ3~H~Dw${$ܒwtI}7^E}5 eBF{ >vOV.?\5^N"7=s̴'o|̶VyU)u\C34Gi~jZ瓷8"ը?> -f>vm-oZԹGg]q_!ףg"]IAIOU[_o2tZ;ru$I$* -Ѷ=vcܶho-Df8 RH1i7lΪU%pP2M{'jhe8)yqPaYd` bl= $qFbPI$p$fGRI N{Џ]@u&}Tr~ 'IܔG5>s=9G4mNkna@i9z=.]ܐi[$x_˯{7ǝk~7Z $g1{Q며r$E5$Z\<\}=_7. ֖P KҀj5G$Py?_^rqss&&ϯ{3iQm7PNuL&a»F MxhϦ=GRgF?3i>Wʵ4>{E..0i=<^/O?ZGFzD4o[w??EyW-߇O׽~'ݕ \fN83.'vmSHԑVbr%&x{c.Fw_Q,mLxβ>eVH\A?Ky}Qo3<0ULt:?~u.TGl>W 񹧭ڸ}:qm8d"o6{卮u;=ͭ5+5ķ8xfJ7ep T|^Yؽ60=0AxUe8(H #Mu*}>G>#quoI5[iU41Yjr<ٶu[$BF%E yeF3N>ꜳ̞cZBop1p,|cIǕzVτm-=pZBIjّHib9U#S˭߻ nF~mnBۢLǂﹽZm>37;h_3ᖝڞ"<uc{N!o# f)Odj/ӛݿ`k>_IPIaɿ 6Xwj?q >{Sh:nśWq{Ky?e}~];{׽e/"܍G!oTZn=X׽ߺ^}Ə>+?>i+!v{[K׽{?_:kJ{GE>?iie[X[֟G8w\y:__Ni]W-?} lʕ)' nJ-Q55 %rǷ0nɏɈ _|Z?b7Ri%횟ճ׽ja{Q:{NA3vT` *ƞ60,OW]֊m1_#sV$נ5?cz|6?X4 ߽_ S++ɍlgV&*NB ?FI}q}P\БO޻Q(L>6hsFkwu?YXTO?#g6̿=Wq>>K_@·B`0{ycy|56?q4X{?u)&N%:UP=r9c`vw6$yդkGӤ &OCm>>r%ɼ[$ w)"ܥu0 LP{/=!rnEEƘcE&3?*y#u&ߛ~7.6?}Ymo-bS$2K:f鏶>{xMђREF),dej *+>m=dIۂYZ wAp*dgtG&I :'x=܏g}M 4NI Q@G }ASKj']A:*,ѡcRLi J59^Mqa"FW ac ظ.H5|C_ٞ=H^E uzNc{w,9ٛ1A]md:SK::f}xK7m}oZE")$v񫩥EUc_e0}Hpdyݕ|H#8|_w^ݔ[N+=RbaaiVi!wv߄A4{_yWcs]m.,bE5:j?NiԨeg}|NqVהwWR A!gicC#'{ aL W nׄ:̮V$TTlTQyje¿arϼsmY+Zcf4gڟp6M7[x|MN*'ԎYwV]-vn qT=G<ҌnVrl(Ѕ7rAQ\z{\0K,9z;gs9̡aӑ#'jĵPrA{߳ٯsJܹn;}D;:Mtqzwoo=m.k'ܖH]ud"U׽f/Իv}Fs)+51RMw6$~漓~'c˼MkaNQK 0P޳oܼySwhk d]%He8cj|Ma~MEYٲk 6y囩Ø6edFi!bQ߽Ox}/r}woiqImȦ;iҁ?(хa*YMoXع=̓V\Hca%F݉5W%N v(N'al}mnJݝ_x@ O+ikG>zbܵG?]mrvSb5Yϩie tm>줙A]FaO^_GuM+[+1Uguv̸ ۙ8^7AYs'G$Ƶ"NHQ//{jy x{}:K4CD-x6 wytJex [ݹ'人p"ۉO");S׽ߺ^wKwGw=;Q528̦㚾o:颫PQg/kݏۛnC{{KE_J5>rOۿ>OΜ յeG(JZq?΋L>` :>c!NMӑo+R̯"'={i-\mKKE,4 jgt[NFw7 86֎GUN\ t9î9i~>+6T1f(ueL崫'=LqOKEZ! $aٮ]ˑo97~sq5ʨgPBHfIc$k Rmr歕1\۱*1$P jTxvtefcᎺ($rݛ[_|=ߜva!n;}[xbp:so {?*{-*ʡxw"EI$b??.IA t}j"%4$n%) ZdjHeju@E)}h#v0Ʒ7+#Qg=h-9nXxSfJH*.AVP0{_e)X|n&/xZ AA+Ԙ3x%#w8`d37o!d.Sݴ8vRCE%`1+unsOv;:s7,ߋt&65U'QM "\|"Tʓ׽]/־c{ %һkuǾ$m}m<&)SNԘŬSMSU=U|UJXC%HӞ~rկ>s߹[ŲJspϥg G qFmAb roޟ;n`͊k]6/Ѹxʣ÷SRʫ$Z[wQ|)ۿwv+;o!)wce*1}-,qZSe+e<>>s.\>ۺN˧SDvQY ƵS<'ol[$PҲ۔:MBȍ”a׽۟w]vO{lͣ9r-2KQʈoQC2s_=oޗO:{3򷷷׻ Ԗ)8Khښє Y}ܽ^>yޭ!{ˉB2(x׽ޙVx*rXLio b/]Zj'I,.{}ayr$m{ gxƎV#asμ߸$.GFFH#N1~2tŝͲUջ766r_w6h L}>/xVKC쇻o܏Л -,Z4R;MBȄaBNCrٹl7GgG&F6UQ #{w|˶iZY2M R1VP8'Xgs?uݫE*WK5# p'Olu}C}tX*׺Zmtr6;[#{C%IiiݒC vOj 7^I[{z5͓9,x4*I{H R#̣]jcg CG).ta$`ƷRH6"EBAw'_c˭}}E[. ڽAVcvZ6+!=Om$}jyv'wdO򵸌5T,W֬:%]Dܽ{˖pw0m/hXo 0Wia'0Jѽs^[09?:kne?|サCݡ}Ú;SgV»! NWpxfaG-M^>gc uy;ޛmy/o߷Lm S\HXV x$q)D@O͟w/f-fY!7s=ԥ` H P/QGO7;ok=0g"jh]"xu41qǹ_'~s;]s%eԉҤB .ƺQ~N]pܝ"U`XUqG^R?P?/#yL-d6v6 r8'8瞑"wErx_iWޯk7G ݜt%'Tz "( @8wOq^o<715K4aK(${/||W0Kݻvh*0ݗ]y#Ncy)+~")e"ʷV֠{f.f/vCy;i2SՍ/i4o/jT-fJญtZ5{޿vV[˧_>7l5y0F2qG]E\#' 3;bI="v_wk;훕ϺWWa]7RR'(TXr޳Q6nlKnu[Ff ~bY$k׽3{Lcusm=WnmxS$UxX4U{9}oydu[ͻf;E^,jB1.y6NRKzhD3w"¹##-F7REm=[Qn'ΘÅ-5QlDᡚUl{rKr?f e/ 4z@W?VرsJsK(9GZթޔzwΜo5ܖ&.zt|:ҵ:ܻ弛먷'}{/3o3͛j?zY|R6 s7ܻfcn޿zKKW--(M3OYv|-+m~,uӭ )%/W{yŝh\?xbfcDl)iHcTAt(Q~l}YnB]ݦG`#{i-g'Y43M,KQ'Μr-].y [;I9P'!@JP׽'wߴ9ѷz;blkun;tSTr۟nQbTT#ah1w @Jj&H4Y0Y_/'.\Xm7\7q~2pNve攭dR(-Bt܉|} d쥎 $yX(5d0h2 hO{WhOh1;v7Qf{ʍ]ܕqѭdjlmRܪ 1EI PIB#*ɛඍDI5{ sYGV@{7?xv$/{ tew>R:Uu#RS1#I*c4b:ZuvgX!@M#˜ lSSZ6v$1#Ú7>v7SnO3TEHHֈB'={ʟʷn'Ǯ޳i7TEw^5ᡟpn/`'ᖚdYH_{_ɺR!b(h+Fn}>iOGjrV ~ +"+3 m?3~o~|c|܎ =W0V\ffh)i$jo[]gݣr܏r9o}wIVh!XVdehcDG+K@딯yf^~Tx)iZ')]#fMzQ* Tzw\{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u$$If!vh#v#v:V lW  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V lN  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V l.  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V l.  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V l  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V l  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V l  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V l?  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V l?  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V lC  t 6`0VVVVVV'6,55` pytFU$$If!vh#v#v:V lC  t 6`0VVVVVV'6,55` pytFU$$If!vh#v8#v#vx:V l7  t0VVVVVV'6,5855x` pyt-VD$$If!vh#v8#v:V l7  t0VVVVVV'6,585` pyt-VD$$If!vh#v8#v:V l7  t0VVVVVV'6,585` pyt-VD%Dd &<  C Ab$$ԟaPc7$ n$$ԟaPc7PNG  IHDR2GsRGB pHYsod$YIDATx^]xTUmLfI'BhJU4Q)+ žm]UtU`4! (齑&7sߛLi7s;s~Ce[34!  r||IsSK4Bkr3(1 U-p2$V~ ]RkrsĬIFz#8{/IP4m4H)OО"LΜlon0M=3}|CX]m3R:%)5hTLJM^f8 :P_i2C2mFzݘUGHdS*c#NB( h"E9RdDh-C~\\&e8} o?=\9L#6 PKRipnP_J[>)J!WĘNԀ3PUPfRwB04cFyk0?R饆&{BWq6%`N(֏ T Ⱦ`d} ɺʍ@7Y\,W B) Hgֹ Y_QpN(laat8MQҥi=fv\F@Qʌa~Kd"`psLZu!rϓU1! y;GJ.T0|M o䄩gk*1}AZBYܬis,ۡ_#D#Ȭ̋F-!|8vG0 :mVץְ<*@>Lٲx1%#ݭHǾ+50]Z4}02XL`DkaXִ26h[9o`x {@ ?KC9gT8F<.gJ\QFC~ýR;;s_2x 1e-Sf`{1XC{1`#`D.<K; :.>bySLWH 񞟥Ay:bX1+{(xM`]AD-D Ժۊc Am_V0"rNzPzB/~(3(!& k/o5f72,T~xoBUX.0DRa,:h)i`$LA )C\GPCv*6\%"@#M l3LYR VdsoZ+c>mqǎ'VV`N7dX`/h8yRR4euq^x TJU Dߋ Rcq\#aJFlZU('O@j?WdZ98-KYJQ1:HMQV<&x0, L_>9Z##$#?XKhuip00rk"cbFSVӏVJrb'Ibvɛߵ5!>8vPTB,Q\ک?+Q_d$Аק\C-x/D7wYL[mž}r8;̒QLftN9-o+BNhoN!-syGpkl{kޫSWJusfBjpMՁH/8? yXF3J%t4.0GXW$ {YϒrU_ T7cd9-4@%P@fFIWAǾ~ZoPBQ*%oZ>vB:˟GɃH~$@sA!eW5sʰG!yazD4Ju@_/<PBЎ20C"9Ja9hODkt衿V:m0\I3#Z ֞vFJAz+WI'; MH$OF+ymVߡb1,f'}B.gsnE5t6! Iy/Y`Tw ֳW٫G,,Ogm̞JּKS]cpr컶E/G~_*C(j -h>2S#Ê R v0Suey $*cTqbJ*=N'ùN,+.!r>VE/!~2ft y@!+X ||TKPg^CmoJV<ψO0c`FeişԲ/ 8ХPJkڟlѷ^X)c0NwcxE)Qh~k4MCj.i[fV'M!@QYIXߕ#޽i7>- tqZi<[/Ks,Mh*uJ$YkA\&H$`Z jT0IK!PS nrkO)Q~4 @RzBZ&Hf;Cכk@DZV OYɑԉPf]e3_Xiݒ#Qn~dٱO̍_8:u,?+1y͊Et`>9Qط'a~dks1V|D|e'SOznY#^!g{j٪H R] M(e LG?d-ћoMuR6]$BBՙd~}⚉7e>4+}i H)Jgt"F'KGr# "#V'X$]T!XiB4y a4Z7h/i a*xr Ex iFB< 7B|T҈~%LX7]o_=17f}[7#47x [̒o/K FP*9Ƶ \=#8W/vH)4A=9'wn3Z{8,%R?moĩq<9CW]d|׾=襈5r}ݓXd*Khٖ2}G@gK`c4.D97I5i6ҵ+']aZ9:v/60 kF^ekg֚2y2t2HQ Kc f{i naYt 夜ΈDZ,P*j0N\,3yj osEhJc=JC]& ŭBX!gvsAB2z'VqDuӌmL"BiE{ kIBw:[PϐJi ظScn ͸a`)BVc"TH%IX_Dž!ҊSL׊?̎oNYlS59GGŅ3MN[JP.w-g[h@ʂi,Wx+@m,qp_Θ3ʏ3x:Bxk_wӔᛌΛ7Gv[+Ȅ̺TZl[9x_𶠙?9XN  ,Ɖq (NP^SB4XZP]+t?CB{^ܙ/(C%-^fHkdPI@mÑ#83#c-jxϪgD*3-s^ЬXP .9zxbr}]CR9Ͽ&.I#So UH v:[g5*n<ޥjcx\;6i(iWNK{ K>1'v+j_?VcMXe)QZ=`~0_=X|}mMEu }V岐y}v\ŕS"ƫF<'68H^yYM+ ek G 6{Qq \(!$U< BdQ$ lqOuf` }3#_i7Y \8_:n/BTzmu`K` F#h%^)(fȶ>-40DxJ) ^C"]6זdFhm,9io4E񾧭_>v;=}`bh>b1;&N{/sTp'{u;ex O@!ے|o<\Ff5R btP~=G7o!ltp8xpjq&?~q SE g :r!j7aM 56m͖|3Fו㉘2 guA6nKZS[̮U#k3H Hs "( "') (Nw]͝`fFր\~k=B٧r|?2@zt誧L(w^)7PP]qp"1XueJȒttܑ$ӽQ)J-7d*?ɴW9[Lພ2 +~HƔip2-J;t@,6ܜwOq${l.ȫ>@Vi!dT*Nڇx@8´+X)C06voLmޢ161-[#9>bx˟E1 ӝ)G=upΤp;/N2me-)c$?Sq{ 20‡D7Wl9hBHvʲL[7o)/bXZk<~EOb}=%}`GALz8qomF"B\1n\X]הoxz/dcAi\XOzMt|w GmC8k|{˖ ya$!AW,oX FRqZ݊(uJ{ܚWSixo&'˼>ĺX6%8?H^˹Vk\茞?|wvq׬/zwɐ#]i}`H`AYZäDҍ;'B Yk͜.-5@\R ˢ<ώ^s׎Ծp AX&EpTEݓymg7yR0D71"07+= G3Wtg當خxr5!džd‡p9.I{wVl:wY#pr}5ɩAd?ŸtGIkn.>!WFuC]Dbmqu~S9v&5sDY9-2^\g:4z<2r=P8$FԽӍ N4+T5] )yL7F|iK`IENDB`$$If!vh#vc#vo#v:V l t065c5o5yt-VD$$If!vh#vc#vo#v:V l t065c5o5yt-VD$$If!vh#vc#vo#v:V l t065c5o5yt-VD$$If!vh#vc#vo#v:V l t065c5o5yt-VD$$If!vh#vc#vo#v:V l t065c5o5yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#vc#vo#v:V l t065c5o5p yt-VD$$If!vh#v(:V l& t0(65(p ytDw$$If!vh#v(:V l t0(65(p ytDw$$If!vh#vy#v:V l4 t 6 0(6)v+5y5e4f4ytDw$$If!vh#vy#v#v #v #vS :V l4 t 6 0(6)v+5y55 5 5S e4f4ytDw$$If!vh#vy#v#v#v:V l4 t 6 0(6)v+5y555e4f4ytDw$$If!vh#vy#v#v#v:V l4  t 6  0(6)v+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4\  t 6  0(6+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4g  t 6  0(6+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4  t 6  0(6+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4  t 6  0(6)v+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4a  t 6  0(6+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4]  t 6  0(6+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4f  t 6  0(6+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4t  t 6  0(6+5y555e4f4p ytDw$$If!vh#vy#v#v#v:V l4  t 6  ̙0(6)v+5y555e4f4p ̙ytDw$$If!vh#vy#v#v#v:V l4Z  t 6  ̙0(6+5y555e4f4p ̙ytDw$$If!vh#vy#v#v#v:V l4e  t 6  ̙0(6+5y555e4f4p ̙ytDw$$If!vh#vy#v#v#v:V l4  t 6  ̙0(6+5y555e4f4p ̙ytDw$$If!vh#vy#v#v#v:V l4X  t ̙0(6)v+5y555f4p ̙ytDw$$If!vh#vy#v#v#v:V l4  t ̙0(6)v+5y555f4p ̙ytDw$$If!vh#vy#v#v#v:V l4  t ̙0(6)v+5y555f4p ̙ytDw$$If!vh#vy#v#v#v:V l4  t ̙0(6)v+5y555f4p ̙ytDw$$If!vh#vy#v#v#v:V l4  t ̙0(6+5y555f4p ̙ytDw$$If!vh#vy#v#v#v:V l4S  t ̙0(6+5y555f4p ̙ytDw$$If!vh#vy#v#v#v:V l4  t ̙0(6+5y555f4p ̙ytDw$$If!vh#vy#v#v#v:V l4  t 0(6)v+5y555f4p ytDw$$If!vh#vy#v#v#v:V l4  t 0(6+5y555f4p ytDw$$If!vh#vy#v#v#v:V l4  t 0(6)v+5y555f4p yt$$If!vh#vy#v#v#v:V l4u  t 0(6)v+5y555f4p yt$$If!vh#v(:V l& t0(65(p ytDw$$If!vh#v(:V l t0(65(p ytDw$$If!vh#v#ve#vi:V lI ` t 6P  0(6)v55e5ipytDw$$If!vh#v#ve#vi:V lv ` t 6P  0(6)v55e5ipytDw$$If!vh#v#ve#vi:V l ` t 6P  0(6)v55e5ipytDw$$If!vh#v#ve#vi:V lW ` t 6P  0(6)v55e5ipytDw$$If!vh#v#ve#vi:V l ` t 6P  0(6)v55e5ipytDw$$If!vh#v#ve#vi:V l ` t 6P  0(6)v55e5ipytDw$$If!vh#v#ve#vi:V l4 ` t 6P  0(6)v55e5if4pytDw$$If!vh#v~&:V l t065~&p ytDw$$If!vh#v(:V l& t0(65(p ytDw$$If!vh#v(:V l t0(65(p ytDw$$If!vh#v(:V lY t0(65(p ytDw$$If!vh#v(:V l* t0(65(p ytDw$$If!vh#v(:V l t0(65(p ytDw$$If_!vh#v':V l  0'65'a_p yt~A$$If_!vh#vD #v^#v~#v :V l4 (0'6+5D 5^5~5 a_p(yt~A$$If_!vh#vD #v^#v~#v :V l40'6++++5D 5^5~5 a_yt~A$$If_!vh#vD #v^#v~#v :V l480'6++++5D 5^5~5 a_yt~A$$If_!vh#vD #v^#v~#v :V l4 0'6+++5D 5^5~5 a_pyt~A$$If_!vh#vD #v^#v+:V l4 0'6++5D 5^5+a_pyt~A$$If_!vh#vD #v^#v+:V l4a0'6+++5D 5^5+a_yt~A$$If_!vh#v#v+:V l4  0'6+55+/ a_p yt~A$$If_!vh#v#v+:V l40'6+55+/ / a_yt~A$$If_!vh#v#v+:V l4 0'6+55+/ / a_pyt~A$$If_!vh#v#v+:V l40'6+55+/ a_yt~A$$If_!vh#v#v+:V l4 0'6+55+a_pyt~A$$If_!vh#v#v+:V l4 0'6++55+a_pyt~A$$If_!vh#v#v+:V l4e0'6+55+a_yt~A$$If_!vh#v#v+:V l4 0'6+55+a_pyt~A$$If_!vh#v#v+:V l4=0'6+55+a_yt~A$$If_!vh#v':V l  0'65'a_p yt~A{$$If_!vh#v':V l0'65'a_yt~A$$If_!vh#v#v8:V l 0'6558a_pyt~A$$If_!vh#v#v8:V l(0'6558a_yt~A$$If_!vh#v':V l  0'65'a_p yt~A{$$If_!vh#v':V l0'65'a_yt~A/DdJ.LKN  C *ACAF formRo.P⨊3L\K.1qFC.P⨊3L\JFIF``ExifII*C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?󍂍 獗Ee?joC{=(+пQxxGZT^+6_֣dƷv 6 ?T>+6_֣獗?͂獗Cej=Ak+<``CCej?PxGZoC{<(+PxGZT>+6_֣dƷ6 6 /T^+6_֣獗?݂獗Cej=Ak+<``CCej?PxGZoC{<(+PxGZT>+6_֣dƷ6 6 ?T>+6_֣獗?͂獗Cej=Ak+<``CCej?PxGZoC{<(+PxGZT>+6_֣dƷ6 6 ?T>+6_֣獗?͂獗Cej=Ak+<``CCej?PxGZoC{<(^ ?ԟW^:s["e!9NFܮ^=3>]#ZmG,cJgDB ab02vR>G u̻ ܹی` S||4C{橛}\ik~FP7wmϧ^h1;D>g'ݽ~]">%6Bn(Ve$ gh_̅/cҵ}Ҽ,b,J`J=ݦ43Jr9&58M|9ݽ~.zzqV?kAq gX@a9ҚqAi_H8a.yiI/e#zrj'1jOoy5[ p>rAF23$moc\az{ nKeCq4jK.ٌ#vʶƳP2`x.dEo= |mUǀuó&3PUڴL;oP+[},w"ȍ. r9u ~$Qm *1;_`^. !hVU GfRIIZN3# rC >W+k˃9oAW>ׯ fsn8J|Qp;R\^Ip`wTT p=*uy;;Ew^ӼururOiK{ݵf;[IpƼZbڡ[vm2󝣺s޳֬.5K+TmXON5*jQO$JEĈb{TOܛQ,OS;0sZ:_o מ<"cA=_XL=kGٿ{GTR,Wu\߄uItHA'Zhm@ aq0 nTx)#=&geڬaTssozv]Gso 7hoJp&S88#zH"ZI튉Yh qr:o-;MThoӀ9d8"AL¾4I.dw\o$nzCpWi!}Q!}V%ههhQ@Y?/ ˳u Mri$rFzWmJaygգ 4䥼v#㲗>4&&)t{dMvqcFr^ X#UY0%I SW<䷎f)ao &#)+Ҭ.m露i Xy| !9l ^A ?A ?´(#?0B0B ( #?0B0B ( #?0B0B ( #?0B0B ( #?0B0B ( #?0B0B ( #?0B0B ( #?0B0B ( #?0B0B ( #Na];pfTFs=*xH"n^X]foOqX~"|牭y#:4 f;h:c.sm.5Ŕ3<#3Lkb8 njI[rw/ iM5qr:H Dj'$G@ Ƀ:$֚^ܯko>Q ӕgݼ$S Zm jwi j]ݥU$:UK{6dh5D>pWt)w#ZE<,Un7w#^,w%$=ّTjjKO2e\!X-޺kƣwV( 39M"8 <ōI3(+h6+i5YG҄#k|"֡ Nkxn1\H%#O\J+x-rdW#m2!7Xwm \ƽo]Qԏȡ[ zzqG#tzu}Z[xlc#n2pWf:ٹ Wo1PU0bf9pq9sӏ4mW2%OHb8dEF?(`Ǐl mbçhc9?1pi85$ͽҌ \H(((((" ( ( ( (с^yvM:ٵXck{,d5a Vm.Q")e&b3c{d犮F;: \ +_`%լQ#?T۽*mu_A-A2;#^;``zQΙ`gyZΟ&golG5<2n3 l 2k,j ӍF}qidނIGr#p=(+ʴxln6{vpʊ}^=q\=Dc A'$t'E',@ts, P? W-NnѮ-ɰRhXͿhYտj^$T\KO7dXUP9'P[IcvqjzUf[Xf~Tn7=pՋbY?6^\LK]p0F{ Ug?pG[\EuImVY-y23 VG ^u7Z@S]σիQw> VrY!On${jxq1(cTu=y}B/Ok?ƏA瞷zhy/bk>zhy/bk.<M5ͫ:bIs=W| R,nіYpq t`v 4+M}=Sr?Zck/j:_\O rGib6@T;NnjT>4!6 G16##.} ~ӂM5_K55W5;dDܑw.]@A ب k i*-Rg A81}Z8ٮƗk?k/'Mg]M^2dRI2=v?sZ췊m;l*+v.H# n?_J|ӽ>H6?k-=(-/h" :QutuƏ#D'7 6p@#/gşA5 g<wkv^&!,$4XRRCNryXڨд;n_jq -x!A.qV>Ɨk?k/>$no Z8eERHl7:{/,kk,昈 Qd.5zk>byׄ8K$o"G"2d{d]Ao*g)I&F-fiѤI"+\Xd9% hJ1PP:VdW/8YDQO#݀MJ }YT&Ɠ-ŅŬ#lUVu։,-%24;J`N0?NsӃh}AudYo )ro5 ;F0W9q4ck$3@ҩ98\z4FVTu6d.m)e$2'Wm&#$ Zk)*pAY- UD`tjt6ʹ+1_sYPjKũI`J+8mpi 9ahd,Wp(eO1፟iM̠ϧ0Y[a Ļ# `5fH/ fBDa}"yVY] \[C0@h/͖y| ȻyVͲ)V4a|Fӡ*X`EV9 }x. E '(n-☡ܞb}FzIlrc, *z" ]AZ@IX1#>A`zq14HZKH]/EȻ+h`.a8˶(n>M0XZs"$?7ȻyVؗ%#>SV3/"b061XzGw?h. 0.T+Gw?iv]AZ<+@h^EȻv/" c,,3h(.2;~4?zjЍP_F\ܿ&;8tG ꡦhSe5& 6ۻylc#,o2Ď#2>8U@O=b!`c5|xLOQka:]>dž9 LQvX֥ÙV+> *K-cirGW9xMҍkmI<;vJ"%bGg NIJWt2Z1!YE jrxEKy:R<'4%$<${#d}`dG+dtKh6l.˝vk0ӭge{hKk{$"o2],MPy~a9Xs#KX擤.K8Fپ$Xڥ,*TC)R;QV)0+h)\ɵ`ecQ/wЇv:֙w Х=f9:f騬3Tmkrˑau;Z ( HH6VH5-iM ┴t+;^:[䧛%n8Z4ko'١0GAL `sۜd`1޴,?b.'5䶹2ۮS*n>~nr88JOEt.d7o eR&I'0Q7w9 SBz1o0$nw Č\Ony_ѴsƗylO^O0>Ե3y.dۅ(T!.Op=ZbvgyHc]~VϾ{ oxD71 Nΰf]qqZ :eZM$ 7l3W ( ( ( ( ( ( ( ( ( o*V| ?yojW?7j?i_B4gt S;p@ȸ2ϼ DbdABK21q\^=Jdʹ9R؝d?0h (.4F)$Rٓ) yDC`n_[t:|%Bmi(=^=$;#Y_E/ɼ#Eʶh@f!w;O<`q\'Yk. %ƥ#+r(;vSgX2ͼћb_7a`B:'𷇵A}o&Hd$P{Ҭ5ՠQvM#9Lwz|}\u%)Y|7 =q:j ;儏;L(KONF RYo&oJgs *PB9-@:&DFFnPx1#k;>{{_kg1vm>՗7ýAf1eWX8é8iQ?$tV2hnlſD\J#lT퇇VuaZѼv2t\nj=hDuɽx*8'H>QY{f*֯p;jIy#;3#9Җef=h=2- )m鐠UʂдQE ( )3@9(Bq@ E&ih(w-bFODZCDZClQRPQEQEQEQEQEQEQEQEQEQEQEQEQEUm?]!Vj~ko(S4 4+U}?yojЍ7 sޡ<6KqC$Re.ybݎNj%ƴvVn`$Ȩ囆!=\mx×[q#ql%򲣩g?4 ZA-tB9RN?[p __3>/Br[i-!2I r~noi]Z9i0W\lp7KkR^jztF9-;:J$U8F#0y|n0I-1 >7,@d*ʬpC{xOƓoq==Ėjb`%2ꎊXGCecmYgipB#t2.Wƺυn%Gc,hKrq=iq5g[ׯB-t϶ˎ\ dtRX6Ѹw5Z[inmWͅd#p8$~4П( puum-1–RnT~t kr h%*> i->gk9bWI[ӭt)kDAm[rO&h/34q,V;PRCRFgyapŬnnPԞO:K Xo "e9N_kՄj/t_td4M8AFyGKtL{26w]H-!E!ن2y}yvV:u%Brv?SWjX@Z~Չ_1kmS{#7fXEq%Ysw>/qk~y iMΦ֨Mi2k5F&Y";+8eHsMZhϋƏCXV1ҧ45kl?͟-8RH8*Kx+!cS8#R?߸4}_hNE V! WsKg5?MiHT3ylC}]h?߸4}±mƗa^؄00=hs晝.s䌅RH8(χƏqkԼsXwL~JF݀vG;= /Oh4hFK@h#QxÚ{aAgYχƏqkƕ{"iRȕW`sJmo]sRcp >XulQi &!>/ƺMƮlVc 0#yi=e8V'fjȢc>\o;IEF|_߸4gYL{xodqP(9)m9.u!QNGѩ?~Օө]?~պ(|_߸4gV ~?[*gG|_߸5n.?~պ(|_߸4-Yc1bY~@GhѦiG\CG`Ѧ?rЍ7w9ZtzZ%̪VU;6)6nI6mTO 2̄ BRESЖ`1NDW(P'oi <Ӹ%i6UV#E^OXЌHY[wgл-4ח;C;c'zһQ)_hV[N4۫G>ܙ8pk/Rs\ ҠG==V4kxogg#;T0xhYèBn.d 8wJ5 <1MC~ѱ2:%A=W/&IY;d) =FKX&V 8+:U-^S0@{7ƍG7gO񮅪\E%ܤ.*d1pu;y s]E8.pQfE+ ?iRk3i Hܳv@w;U״[eX̃v8P}E]Vtܞ]C 'R6s xFw 9LO^:fFi,ѵ;Oxlgkt_H=~sHPVۖpxE]VbkZdl$%$=ˏPK$_oI#$# y{q!s4YQYsk] h͏;|lϧ$,Ɲ {nѿ*Ir@ǽ+04謉Ge1Es#|w TR npFG5jVZuޝmzddhĀ3 p} r^"7늹HaEP?_1kmV'~[ŭM쌟_Ik-8[MMWfGlsUf4_lehUcfARdw8k[qKِGcbb;N줓9W8M+ToG\ך HSG6'FߵF>7, nm,;}4 9>TrJHnbw\G;?/>6n>mi f}|gɷǯGQdi7& 1FIMq#gڋHU6r9 FR$wi"I+28#gug-:>ZrݸGE1gÛinmu;$&h(%J@<}8 |O-%Ycr*>׿h/rd1o9&64~[/L|ն^|9y$7VY#TGPkoνHcK^Ϥ_yszRkRѼIÌV{>Ə>}"+ǥ:׿h/ҳ˔U?:}"uE,*{>Ə:}"arOνHcG{>Ƌ0r^Ϥ_νHcE\ES/y׿h 3Fj{>ƒhF ,=5{IUs_RFF#MLw0u_&u|OlO>KHz翙cޫx!n%/#ۃEZ׿SVX[3<1T3{03A#KX)!8 ϖŰ98 R%ԧyx/ͿϞl3~5-s6O} 7+>~FTNb?*t!nEٺktp$LD%S><^PѮ\_ޅ1Ifߠ8ϸ][cN5ufwfQnʰ8V -$.`X 'yGp;UQxm`Fo9{=WgJ1j9|(ZEp)VBXw5X#3$kYc"?%r} =kCqLeiuYEv HT ׯ6j^Ow4+F8.yI3ꄒ=묢fGä9I2Z Lbyfym'UID gj-ǞTgb3Hӵ[]Aoͽ<}N! VO+ |7zs0Gifpq;$*ElE /+3TpV_NmhmAw?F 膪G,lD# r>xrDvcW2M_2@LV|Ƒi511Fٌ>Lg޻ )s0GyP)onV Jq|%{N4GX;EvSaʎY<"xoe7!<`86vڑK۪&9amAs}5G3X9;a enH&&B ׯ, @mc0ۄɰZ)]tbevHcw`|3\q]}%- $ER@Z~Չ_1kmS{#'cu3Ϗ _c<-n! .%Y7<{:WGgj.m̏Gy3!sК'壚5)ul[`'rmC`vy']~kTb5hu@P}ORMOEA)?_&I?_4=ؤ>']~kTb5hu@P}ORMOEA)?_&I?_4=ؤ>']~kTb5hu@k__}SA}O[I#Afr3fF#TGm`M^\ܿ&;z4")u?ou~RjHӭu~z(ӭu~z(ۿQuU=ۿQuU=u~w:ߪAuT}nOE w:ߪ>N_ꧢ}nn[S@>N_ꏷӭ>N_ꏷӭdn[GۿTP"ӭu~z(ۿQuU=u~(U7PIUV\?(;-bO/ы[oڛ"hV~hR{ (QEQEQEQEQEQEQEQEQEQEQEQEQEQE?zjЍQ=G5{IUs_rF؈:? ^VI,0h݀ OG?(EW=a֥(`֣u?h2_u?}ZEW=a֣A(`֣u?h2_?u?}ZXZQUQ{j4b{j>Ow_FXZQUQ{j4b{j>Ow_F,QUOw_GE}BSԺ\8V 9_1kmV'~[ŭMS6Ӵ+nXe$#$w?di~GM$-nd $YK{~*U/ϵG,}y~(y~)Z,}?dh}~GC?Q?QxvGi7s4#hϵ]υHύ߁?F>tK>% E OϵG,}ߚ?|/o-?{F>4#ky~(_^9YG_ߑ4?IQ{~(;~!i7s4#hϵ] GE OϵG,}ߚ?ߚ/߈Z,}?dh}~GC??xvBodh}~G #Gk?ƺ!>7!>7÷~= #Gk?ƏY?_ߑ5i4i4^9Y?_ߑ4HύHύ߁F>t?C|oC|oo-?F>7N>Ui4hߊ/߈ZAxkXDKS>f}}xIgvƧksvJȲFTj]- $D &#K?G'w?-j F1W?h/o;kSOQ Zº_?s&?s&h/o;kSOQ Zº_?s&?s&h/o;kSOQ Zº_?s&?s&h/o;kSOQ Zº_?s&?s&h/o;kSOQ Zº_1>w?9rO?G'w?-j ߓG;h!?k?е'+;h;h!?k?е'+;h;h!?k?е'+;h;h!?k?е'+;h;h!?k?е'+;h;h!?k?е'+;h;h!?k?е'+;h;h!?g?/'w?-j_ ?ߓG;h!?j%chZar߃YsVʯ<Q+:8ֵD֊AYHovE@5vn+q3zT\ {Hྵ |1) n@me;:I;tҾKc dsF\ljGO6X$cpFYL l4O]ܒZ8 R]Ù=nka83eqJ}N;iy8H@0+ZΑ/FcIm&N#sǽW>b=ۧWqs;lz0l{{vxH $FNI W ֞X[_#Qvp=u4Z4ga,+#XOӜfκ+y&)X"-# 0X^}-R]SQA9mP`?nyGPsE߆S]ngB®Od5%7p7GC O}M(侲iեv zQp&Ƅ\Ot S: AR["6\G#:mi>mJnͮ.V;7~9WK(Kxb+FKvx  Ox#'Pnw:!*ݝፘ88;4Wq9K5KO٠X |ss]%CEPQKEZ((Z((Z((4ӇU UMGPIƧ{mΊBG2cV5-ȑ[E^i?#ڃk9Y?G,{VJRβ& z \giH71xE<3=x0 ޽r^-׽-??fkޖd_tjvI% 1 9Z.F3@7A=WMKfi~ 3^Gk-#Fڢ*24O]T $1KsPr#Oqړ]|˿5KOƏY?U$M)g,+;Ue𞢅yFJ%a_3?  5fkޖ5KOƱ_×P_[\M $/!}==նbY'-OgՖfkޖ',{nMNs$Ʋna!Tx`ZF^i~׽-?o)aH.伒 |99vv=5VxSp5Fi+r5KOƏY?]_* {h]{Mgu,{fi~W B?Wh_G#g[׽-??fkޖu/Wo2./)ha9_Y?G,{~?Wo)\X~3 3^GhzZߣ5¯ѿ_~?W/VοszZߣ4׽-?Wy}/Q Fk+g_׽-??fkޖto(_G?eޖKOƲ/\~qUj2ϕV i|?8i@eqS?lsU5VMAk+ ?Tu kh[7֕H2OZ/?5SU7%Ym#V  u֘,4pJ2H "ȁІV u] /-jʉ M]tYP34"BU+FNŸJvTāYr oQVb`E BH<:qgqO Ԍw$ sύ9Ucq(dsύ9TP?m|n*[W`+ ֦z[ :ۮmexD}gFmܶZ|F FOK# _V Ԭ(&U8^]sמ~.^W%eo/x/oʏ&_ߕ}Oýl]Y4H,|=;XV<]o߀}semQc+(g}7 O/oʏ&_ߕ/cm/O0_jV ۃ ddC"1۱RW޲|~Ty26U /eO[ -{)X h(̘G0!yY^LͿ*<~T2J6ZyNfTԘה.]c ǀ?ɗyG/oʶAZ-"kHc֯EF̀ H;;xV*]B*6>=h=kO6zm4yo?+K^F_:yj=i|[oeZ]8zxoyj?C}Ǜ}=n?ﶣ;QyCWmڏ6zmGZ>Cb;Q[ƇZ]/(r+čA#do/oʽ;*Q2v8fz?'J#]WvҧDRҸ_5j7[GdӉ'% 츕 *?*]rUj:#Ak~S'00jjSEpxQoPfFĮhPČ;dO$R\/ԝc<a̎ŠWwm`iRTP39X2?~A6}}`b!H?i>߱Gm?(~A=`bϬS?~Av}}`b#H?4uq?v}}`b"*\B?v}}`b+KR"(;3v}}`b&} <B~Q;_`&PHFvp0qO\՟ϬQ;_*\B?v}}`bbߡQA~R}`bϬP8ߡTp(HH\?_ϬTZr*}QB` o U(*?/j#f.5),Wu9q;K"|maROʸl⾓M[H@\K1crwgh;zP5kIrcce3CEhvSjzʸ;j{w$R$C& $O+>NɗSگiƩu%qo & yܨd1'qހGFGJ)\vBm_ʍREMQ?*Z(Y ?*6GKE !6GFngڼU׵kO/YZ k!H?088.;OʍW!IK(EżCDv:կxz]PM"bA {Ugku{.*GK\֯5޽ku-nR#9=x쎏jt~TW~UkعP{+w/ʹ1zWt BmSGay8H^02ׯCOKڿWQJaWjt~TPBm_ʍR@Y ?*6GKE !6GFhds-[ŭX.<_oߵ73}~E1 [w3DT+=(.HSQcOd8M`iKT*/~]Ǡ8siXۓxY(>OJmhʘc*TF=G(^b+'9P(NvȫZh؈aN>o<)Y!.6h=)$Q dިn(sMPHO! * d֌r `ʑnaCXwȍc)#PlnrgƦD0Z]m0=tBkύUm-~(-~(msϕN-~(-~(kr_*O>W_T??ϵ?]+Q+nOGnOFϵ?]+Q+nOQ7.L0~?Q~u|Gڟ|~s?ߴ >s?ߴ 4 DSϕUjW=~(=~(5O>W_T}_*?'O?'O@O?]+Q+_??Q>u|Gڟ|~s?ߴ >s?ߴ 4 DSϕUjW=~(=~(5?]+StDH3$ꭌJOMGYY<“2z}h 7Fwo擏*?/j#f־е;,m-1ڜ"!-s[y hp,18SsM>*ކ(gGDm@.2s`cԊVe wr_ $Fȉw]<ҭA[Icwt,+h gP(`Oa <06F)k2 Fp#U`2=CW q+50@ (; @lӳ ˿[\+"74 tH<88:hɝđ#de l0{iYYv"X`PRYubO+NQ@ y1g>ZT Ɖ#lrK ?}P"+WYy ocbUOVt2L/NI#}'{۳ >Nb1Fȧ*.6O=m `9V! 8c]Qȃ}@U(?^Gh*}F^Gh+* hw"q@~[ŭX.<_oߵ72}~FzMױBŘ Hj8)k.nb)#!v"6&5d*89m'M}MТ夎n [I $BT"W>crzRN ,qyP͹v8.>Ts[FDmܰ &y9;~_lێշr@ӏJAbn#S`u9L;y]r*@Eb0Fb~b}:T__/ʋE4ѽQ*QT__/.^޿_Ϋ }| _SXM9VLq@\?lܶZoe_)hfduig TwPYiWyPӖwD62c5]e$@ BWq3Ux|1C5@S5fYiƻdFǽJoa |ҪFO pАij^x֒QmBXICs{@⬾i*]F[Gn8m@L(wZ\`g?PM.]ϔ.;}~]ϔ̻(?c@\w۬(uA7̻(?cGw>PƀYQ? ow>PƏ2|qn?2|eAmFKY0Mkl76e8580<] xF-mjw{#7T\ \ OsDQE (*65,Sn#YЩ>xJjQY)FP4Ax{^?( T;U Axb)@\EQ-n?J*AhqP/QTw G|RzZ?(-U)FAh.^?J7 G|rGqQZ?( ;R)@\U>|AhlHy]cǧҎ}L7Fwoؾj12,b@io U(_K"|a^iV`wL-\4{7A䜃LP= b Eb61:]JTpZ6z"CjTWdzO ), VgmAy4mX.iQYmy/Q`Ef/Q^oE^oGiAy TVoiAymX.iQYmy/Q`Ef/Q^oEOAw?#Xʆ95YE+dt.<_oߵbx@Z~47kB7kBQ@Š( /[#G -m-?\wU(+?*}xG|L\?Uh|n?4⩊})h|n?4Dq@\<"3ύUh|n?4 </Qx?_}oύUqgxE| >ϴM>7T}o.?GO*M>7T(</S>7~iQO*<"gxE| g&?>7~iPx?_LDqG&?})h|n?4Dq@\Ӕ!Upp)h|n?4⩶+$bv3fpA8'Ҁ(i6k[-U5'/ Onγ+\h OLsU3Fwo?us_rFo~DCo8rY޺:-g}h&A;my;ZrUrmBx 5b.W)ŭj#M֩;dq>)SKkh5B#b3ִ0)iQEQEQERoVs"LIWW p/"BϷS})LEj|F>ʘ̽HcFg'ѓj{>Ə2}#SFOeG<4jr}M>yh/?ѨhY4d^Ϥ̽HcFg'ѓj{>Ə2}#SFOeG@Z~Չ_1kmS{#7T\ \ OsDQE (+];Gi3,lAKx70g55ō􉿑O 4a5nqB?4}_>}(e?O?5/`b=W4)oO&na| Q_ئ+ ( 7O|OD?/Q_ؠ,34'$ĆqǠ_بtnʐAnA 3FwoKkl4+ 7;35-=jZbyg@d),y"[ߑk[$Vf W Htu NH 1u?:tm[X{{ vWMGp{2o C2Iˌ`@'pOҕWgAepw lKt?1H 2x޹M?@O}03R6Mɏ';'?ZnZl cwH$t( _MT_]?YN#`x=\E)ci& i4fB"$tmUtJ:e6jb5Dx뜓CHiiQEQEQEQkzB!cW&L$vSV&RuS 9Q!b:Ƶ<"K=mqۨ筯=SGyW?q֥G9R1Hec[_ɩ3zMVF+PU( =m&:b5u[_ɨΡk5X@Cj3zMV(P+PU( Wۼ-Pd&U OAw?@~[ŭX.<_oߵ73}~F<:jp<ɣAM#3nc *:QG\ׅ7d5 jFWs1N ܭD;pԏ/X_iQEo٦ /υ֕\,fY@>6_kISQpGύ>/GQpGύ[d15Z]!G@gi6k[-Ww?/j#fM;I/dFty' }j o70=(~zu4k2GeV qA#8SK-2= & [6 t'2 0+M%Ze7 ̻qe})M= \ v }!z wҌXV' 7Kki)a89OA47B͸\,ߢؼOc%4-Ԅh€Y( 2CS=2 HF+]φ = rǺLD,bC۟ i2fu$gsʠߴ0o̓9sbıIr}- Lᕛq-F9ܾcx0]щ\a#<=SJeo0>2u}/tޟպ֮SSm7Lmh$8f8$ tOhσXs,bp2ː^OI%)f i% rG} hjgzU!tϳG3Ok+Hׅ&pFeC8) F^H It+ceӆpM] ujzχ?ƢLwFvGC83KPЩ4g[zG|?ޟպ(XtXz;Zڊ(@Z~Չ_1kmS{#'Sҿ\ .nA%GJQ+9O= FL)hU*g5iuxSOԴY1D%07Fn Hh(4 Xh7WRݶ/e>RU=?]ῐE|[G?^mEc+/7 ?ѿZ(?ZP+eMy_u}7Vs~!Oe)eeyc=\#);+ !I:.~pXWXXɪ-Ķ/قv%G\{otSOP1xhuM[.'RDdk0GyqQU(6J-QK)#-JYhTگ@>q? ߳\5vS-K~/O&Q@q?ߴiֶwvf$[@:o S㳏QүfXdbJf#nwJWs_RF[ߑ_PŭrFfRR2 sQ X,n]]ͱX N: r(rQ 35Η2L`H9}*y<1d,%qBlq+$ .dsx> _2Gq=۶|``gVi0/۫96#=2IH:kY̑Y܇6lIRAxE $h:-BMI# uע/+koͤimx!DL$a:9=r6 uCa+!q_z)5.)ai:TzHwV"v v3rI(PQEQEQE@Z~Չ_1kmS{#'Xb[dWE]X< fIxʐ0KO FrKI>l>ywVbY`ySZp_啐J HS:SlmOK:yјX|Ǝ>\c A|PE%E$1r DA霒{w vl!*X֥Q Y1#=Oҕo3:ֱىm{U>-MȀm-y>wn`f"8,7*_ARydwgwEϹkWȫL"aU`,yi[\%K*,1F0@&J"@U3mxTs~(/5/h_N?TywCoM6S?U]*oM6S?U]*o/ͷllm 5cq ⩛o筷o*2qwDsv#m<m?).+z߶1=mT7=]bz߶mTrKF/筷o*vm~@\ERmQm~.]bz߶mP.T=mTbz߶ (U1=mT9J%۾9 |qSElܶZM;`w g it5-[X\T,׮8?T"!_R ƒX||dNTgߑT<[$"ǧ3$#+Ac[X ^1aQ[i ($~9Z{NKyIP*H5u;/G2H!WK" s =j:4Cbd2@2K<764s,$QjgxEӛD'8pAPOCklb$K;czr'mix4u+ =Mѿn-[Ibv2q(h5*"]I-Jc,Yc 68pkz [C4#n@#. #m%Zmo`n10ۜ}} Jl:,v)e6U##EK\?gN ,˂' ۭ^I8*fT=?e, .rH:-C@~OF|[kic, `d;u-Kdy-IJBJ7b p8-V$մa6*etBn=f"tNeb mxg=2|MzRwƑˈ4 %q<^g͐2IZ 8exߊt8JMLI}qoz?RjE aV C;$CH̪¶@p*jW7TǩE(X1=mT*/筷o*_[oUrKF/筷o*vm~@\ERmQm~.]bz߶mP.T=mTbz߶ ~.D_oˣf=ԎQ+f/xQiP~{ qTú'(\<sy:\ /s_ Ӵk+HSdE2 ͓wnսIJi]*Ā ']\vG7quzʐ9޹_| Z)'RŁ7#Ul#dux̍I(Kuh=]}`@h_`K?W_-1*:{}X`@(`G?*?{b{}X`@(`G?*?{bX}o)~Ow_KdeFvػdh+M]rAjXo)45-!K[]n8:>GU-˦SNe;88(:Mֲ< dseǙ#9ݮiݓ?k?Ig%/bܬ]fe;HaCqtGҬ݃$L U?Ik?ٖݓ?>CPfZvOGed4>ٖݓ?k?Oh5ed4fZvO@0} Ak?ٖݓ?>CPfZvOGed4>ٖݓ?k?Oh5ed4fZvO@0} Ak?ٖݓ?>CPfZvOGed4>ٖݓ?k?Oh5ed4fZvO@0} Ak?ٖݓ?>CPfZvOGed4%R:JKoƻAc/s] (3Ono,gi#`'z,'}oߖKe6ƎLXŽH#祟o*:ěOF>t~^=,Tl祗o*/+Os4Chϥ]OzYߦ٩K/UZ?di_~ #JK?ƺ//T_4Ck?e~f=,T^!jϥG,+}/j7GK/UZ?di_~ #JK?ƺ//T__/S_/ONҿF>t~^=,TyzMQzwsF>4Ck٩K/U5?e~ T,+}/?di_~G7GK/UZ?di_~ #JK?ƺ//T_4Ck٩K/U5?e~ T,+}/?di_~G7GK/UZdi?~祗o*f=,T߈Z}Zγ_A Wg=֓{{h ʋK WMcZYߦ1Z߷sFkAOSK?Mб'筟*OUsCrO?M^б'f=lTl筟*4?Y7s_^б'5?5筟*OQC'W,jhO?Mt5_g~f=lTsC~5 ?:cSO].Wzߧ٪[?U_9g߁uyBƧ|&N?XKU6j?G4?Y7s_^б'5?5筟*OQC'W,jhO?Mt5_g~f=lTsC~5 ?:cSO].Wzߧ٪[?U_9g߁uyBƧ|&N?XKU6j?G4?Y7s_^б'5?5筟*OQC'W,jhO?Mt5_g~f=lTsC~5 ?:cSO].Wzߧ٪[?U_9g߁uyBƧ|&N?XKU6j?G4?Y7s_^б'K?Mt5_g~f=lTsC~;f8,A2:Wjiom5}:qo"]hՔܜȨNV*)J^{#/??JZ=#V޽śg(YHlm4Rgc HJKaq|$TI1cp1kKᮤ6FߝO<ð4X#;%Ka$#lK3W4ߖ-I8ǙEw 2+G ǺT"敗toؤ>dt2찼 ȣ뎝`VߊtKmon,g q5:V>˥Gw&u$`\Q~;Xr)H+뎸Sbg 8?5w5.EYua@J'^}+ztnDeXfcNs4mwA3:E4nvV8SR金H/t!X-һjӺ (A$l֐OJ9E7FyMs*۴xk]"GKv\൳ԴEnͬb:~fNN8 jگ-khFlgRy)vLދr2.P.=GX5{FEZy[ FSF 6ץPՁ6Ţ)&EBL2Os"+FǮ<cTkhQy3snwɃ0 v<;s(Ӟ `@ͫO"0>->lӥ[-֕V`c2"/B#Y˹46H F[<+z)?ݟ?Qg/G@hCvS~4~4_vG?ݟ?TCghCMhCvR4~4?ݟ?Qg7G@jEghCK_vG?ݟ?TCghCMhCvR4~4?ݟ?Qg7G@jCghCMhCvR4~4?ݟ?SE "GUw zV?v?{e_+S L_Fm]nXzGaGe89y\!rU=?9+oj4>Ajw6v_cEkR\zj6L,1H)2A{|~*8Z[4ݢc30nN:Qa{W*[uy--[!+:KdtˆP^*M.!mc).v-e3דL{f+}]gŗvZZ5KR<2b岫_ۡMXo]Bqd.0:<~tY2; GG7ZSA ' &7$ Y- tT~]sOqymeJ]Is(PQEbQE((BPF( Q(QEQcU===-6QqXCj1_ͪ\,Rơk=-6QpKcPڮE,_vj1zZmWhb5K_ͨơk]X=-6v.)bQCjE zZmF/k]X=-6v.)cPڌjU(XCj1zZmWhb/k=-6QpKcPڮE,jQCjE zZmQ.7vnZѢ[Fm]mM[Fm]m/]I(9y\!rUASMWhПΫ!/bt۫1[Ҹ'de!V>F_cF싯inP"J`Cޚe [4QFJcªZ --%Yz}݈  "Ϊą$ 8ByJ1!1\c>qJlIhFJzgA=>y!NҪ0\11!r v@`Hzv;xc hg(566A,AMӊ˃:d ̄yL*#.K1ĺb"ufs`9`n~=:sJ.qiKt Sۖ J++XF!0\V㿽P_ifȹP8ٙT, 2kJx-Y"nW^P(U/ub{eO>&v׆3#> ꨬ=GYm/OYXJ9?3c=}8|Id-Yd1Og S9Pd AEdKةVb8̅6~7nv9WZtw[df ,fBK##=h ~$4vԳ3 -v6mFGj8|Kc=!p#lyHWPr| vatoXkV[B%gСBI j?H6*_4~0ǜg8>toQXi[ 2(&')^>`H# -.@췹ca)# r iYѷERηrYXuA05}Fu;]+MV7FxoOщdQgS$BI89BhRSKmeKd@Vu_ohtԉ go p2 lb+_؛mIhÝYeb,[VeVM.ҍpC <玴X.+ ĺe%K!70q^>l}*mGYM$o0 "آ_Y+F9bv\䁁ۖ"xcyw q$Ms^‹Z<1D*|8ݒ>x&KC#bUNX18`:+E#i6ʀIn>\78[4EsڞICh aghڣ91@΂ɷ7I-Ծe*8=UmMe460(