ࡱ> FI56789:;<=>?@ABCDE |Cbjbj&W&W pD=D=9p` `    8VSx^TTTT&&&Ұ԰԰԰԰԰԰$˳}T &&^&&&TT/ a(a(a(&p8T TҰa(&Ұa(a(T;}Q'`#0SnѶ3(.ѶѶ &&a(&&&&&a(&&&S&&&&Ѷ&&&&&&&&&` : Title of GuidelineDELIRIUM: Prevention, Early Recognition and Prompt Management in the Elderly PatientContact Name and Job Title (Author)Dr Saleh Ali, Dr Steve AdejumoDivision & SpecialtyCare of Elderly MedicineGuideline NumberCG19-030Version Number1Date of ReviewDecember 2022Approving Committee(s)Medicine G&RDate of ApprovalDecember 2019Explicit definition of patient group to which it appliesAll patient Age>65 Cognitive impairment , Severe illness Current hip fracture Polypharmacy/ treatment with multiple psychoactive drugAbstractStatement of evidence base of the guideline Evidence Base (1-5) 1a Meta analysis of RCT 1b At least 1 RCT 2a At least 1 well designed controlled study without randomisation 2b At least 1 other well designed quasi experimental study 3 Well designed non-experimental descriptive studies (ie comparative / correlation and case studies) 4 Expert committee reports or opinions and / or clinical experiences of respected authorities 5 Recommended best practise based on the clinical experience of the guideline developer Consultation ProcessTarget AudienceAll care giversThis guideline has been registered with the trust. However, clinical guidelines are guidelines only. The interpretation and application of clinical guidelines will remain the responsibility of the individual clinician. If in doubt contact a senior colleague or expert. Caution is advised when using guidelines after the review date. CONTENTS INTRODUCTION Epidemiology Pathway Prevention RISK FACTORS DIAGNOSIS TREATMENT Documentation RECOMMENDATIONS and KEY MESSAGES References Definition: A syndrome of acutely altered mental status characterised by inattention and fluctuating course, it is a medical emergency. Delirium is a serious disturbance in mental abilities that results in confused thinking and reduced awareness of the environment. The start of delirium is usually rapid within hours or a few days. Delirium may last only a few hours or as long as several weeks or months. If issues contributing to delirium are addressed, the recovery time is often shorter. Prevalence: Delirium is present in 1-2% in community. 7-10% over 65 15-25% of hospital admissions. 15-53% of post-operative hospitalized patients over age of 65. Up to 70%-80% elderly in the ICU. Up to 60% of nursing home residents over age 75 may have delirium at any time.  DOsDONTsFind out cause for deliriumDont prevent sleep at nightRe-orientation strategiesDont disturb patient sleep with unnecessary medications and proceduresOptimize any sensory deficitsDont catheterise unnecessarilyHydration / correct dehydrationDont use antipsychotics unless other interventions have failedProvide adequate nutritionDont physically restrain patientsFacilitate visits from familyDont frequently modify patients environmentCorrect hypoxiaConsider patients fall riskExclude infection and treatTreat constipationReview appropriateness of all medications General principles: Prefer oral route over IM Give smallest dose possible 1-2 hourly ECG should be checked for prolonged QTc. Use lorazepam until an ECG is possible or if QTc prolonged Haloperidol number one choice Use Lorazepam in Parkinsons disease, Lewy Body dementia, seizures, prolonged QT, alcohol withdrawal, and recreational drug intoxication Olanzapine can be used in patients with history of dystonia MedicationRouteAge of patientDoseFrequencyMax dose/24 hoursHaloperidolOral<65 years 2-5 mg1-2 hourly30 mgHaloperidolOral>65 years0.5-1mgHourly5 mgHaloperidolIM<65 years1-3 mg1-2 hourly18mgHaloperidolIM>65 years0.5-1 mg2 Hourly5 mgLorazepamOral/ IM any0.5-1 mg1-2 hourly4mgOlanzapineOral<65 years2.5-5mg2 hourlies20mgOlanzapineOral>65 years2.5-5mg2 hourly10 mg Delirium causes: Infection Dehydration Electrolyte imbalance Fall/head injury Lack of oxygen Reaction to medication or substance use severe or chronic illness surgery Alcohol or drug intoxication or withdrawal. Biggest predisposing factor is dementia. Delirium prognosis Higher rate of mortality. Higher rate of institutionalization. Can persist beyond hospitalisation. Prevention Identify people at risk. Nurse notices not sleeping well. Pharmacists notices on opiates for pain. Physician notices history of delirium. Provide a calm, quiet environment Keep inside lighting appropriate for the time of day Plan for uninterrupted periods of sleep at night Help the person keep a regular daytime schedule Encourage self-care and activity during the day To help the person remain calm and well-oriented: Provide a clock and calendar and refer to them regularly throughout the day Communicate simply about any change in activity, such as time for lunch or time for bed Keep familiar and favourite objects and pictures around, but avoid a cluttered environment Approach the person calmly Identify yourself or other people regularly Avoid arguments Use comfort measures, such as reassuring touch, when appropriate Minimize noise levels and other distractions Provide and maintain eyeglasses and hearing aids Giving the person the proper medication on a regular schedule Providing plenty of fluids and a healthy diet Encouraging regular physical activity Getting prompt treatment for potential problems, such as infections or metabolic imbalances Symptoms and Signs Because symptoms of delirium and dementia can be similar, input from a family member or caregiver may be important for a doctor to make an accurate diagnosis. Signs and symptoms of delirium usually begin over a few hours or a few days. They often fluctuate throughout the day, and there may be periods of no symptoms. Symptoms tend to be worse during the night when it's dark and things look less familiar. Primary signs and symptoms include those below. Mental status assessment.Start by assessing awareness, attention and thinking. This may be done informally through conversation, or with tests or screenings that assess mental state, confusion, perception and memory. Additional information from family members or caregivers can be helpful. Physical and neurological exams.Performs a physical exam, checking for signs of health problems or underlying disease. A neurological exam checking vision, balance, coordination and reflexes can help determine if a stroke or another neurological disease is causing the delirium. Other tests.Order blood, urine and other diagnostic tests. Brain-imaging tests may be used when a diagnosis can't be made with other available information. An inability to stay focused on a topic or to switch topics Getting stuck on an idea rather than responding to questions or conversation Being easily distracted by unimportant things Being withdrawn, with little or no activity or little response to the environment Poor memory, particularly of recent events Disorientation for example, not knowing where you are or who you are Difficulty speaking or recalling words Rambling or nonsense speech Trouble understanding speech Difficulty reading or writing Seeing things that don't exist (hallucinations) Restlessness, agitation or combative behaviour Calling out, moaning or making other sounds Being quiet and withdrawn especially in older adults Slowed movement or lethargy Disturbed sleep habits Reversal of night-day sleep-wake cycle Anxiety, fear or paranoia Depression Irritability or anger A sense of feeling elated (euphoria) Apathy Rapid and unpredictable mood shifts Personality changes Types: Hyperactive delirium.The most easily recognized type, this may include restlessness, agitation, rapid mood changes, hallucinations, and refusal to cooperate with care. Hypoactive delirium.This may include inactivity or reduced motor activity, sluggishness, abnormal drowsiness. Mixed delirium.This includes both hyperactive and hypoactive signs and symptoms. The person may quickly switch back and forth from hyperactive to hypoactive states. Delirium treatment The first goal of treatment for delirium is to address any underlying causes or triggers for example, by stopping use of a particular medication, addressing metabolic imbalances or treating an infection. Treatment then focuses on creating the best environment for healing the body and calming the brain. Treat underlying medical cause. Frequent reorientation. Avoid sedative medication, unless destructive and unsafe. Sensory adaptions. Supportive care aims to prevent complications by: Protecting the airway Providing fluids and nutrition Assisting with movement Treating pain Addressing incontinence Avoiding use of physical restraints and bladder tubes Avoiding changes in surroundings and caregivers when possible Encouraging the involvement of family members or familiar people Medications (e.g. Haloperidol/ Lorazepam) may be needed when certain behaviours: Prevent the performance of a medical exam or treatment Endanger the person or threaten the safety of others Don't lessen with nondrug treatments The degree of recovery depends to some extent on the health and mental status before the onset of delirium. People with dementia, for example, may experience a significant overall decline in memory and thinking skills. People in better health are more likely to fully recover. People with other serious, chronic or terminal illnesses may not regain the levels of thinking skills or functioning that they had before the onset of delirium. Delirium in seriously ill people is also more likely to lead to: General decline in health Poor recovery from surgery Need for institutional care Increased risk of death The most successful approach to preventing delirium is to target risk factors that might trigger an episode. Hospital environments present a special challenge frequent room changes, invasive procedures, loud noises, poor lighting, and lack of natural light and sleep can worsen confusion. Evidence indicates that certain strategies promoting good sleep habits, helping the person remain calm and well-oriented, and helping prevent medical problems or other complications can help prevent or reduce the severity of delirium. Delirium or Dementia Delirium is different from dementia. For someone with delirium, symptoms come on over a matter of hours or a few days. The symptoms of dementia come on slowly, over a period of months or even years. Delirium is much more common in older people, especially those with dementia. Dementia Syndrome characterise by: Short term memory impairment AND At least one of the following: Aphasia language impairments. Apraxia motor memory impairments. Agnosia sensory memory impairments. Abstract thinking / executive function impairments Causes impairment in social and/or occupational functioning Progressive course Dementia and delirium may be particularly difficult to distinguish, and a person may have both. In fact, delirium frequently occurs in people with dementia. But having episodes of delirium does not always mean a person has dementia. So, a dementia assessment should not be done during a delirium episode because the results could be misleading. Dementia is the progressive decline of memory and other thinking skills due to the gradual dysfunction and loss of brain cells. The most common cause of dementia is Alzheimer's disease. Some differences between the symptoms of delirium and dementia include: Onset.The onset of delirium occurs within a short time, while dementia usually begins with relatively minor symptoms that gradually worsen over time. Attention.The ability to stay focused or maintain attention is significantly impaired with delirium. A person in the early stages of dementia remains generally alert. Fluctuation.The appearance of delirium symptoms can fluctuate significantly and frequently throughout the day. While people with dementia have better and worse times of day, their memory and thinking skills stay at a fairly constant level during the course of a day. After delirium The symptoms of delirium usually get better over a few days to weeks. However, delirium usually means a person will have to stay longer in hospital. It can have lasting consequences after the condition has been treated too. A person may have distressing memories of delirium, sometimes linked to feelings of fear or anxiety, for months afterwards. Those close to the person should support them to talk openly about their experience and feelings. Delirium is linked to a more rapid worsening of a persons mental abilities and function. A person with dementia may enter hospital able to do something (for example dress themselves) but no longer be able to after having delirium. This change can be permanent. Delirium increases the chances that someone will need to go into a care home for the first time. In some cases, a person will not have a diagnosis of dementia when they go into hospital, but after having delirium their symptoms will worsen and they will later be diagnosed with dementia. In these cases, the delirium seems to have unmasked the dementia. After delirium, a person is at higher risk of dying in the following year. These complications are more likely after delirium, but they are not inevitable. However, they do mean that it is important to be aware of delirium and work to prevent it where possible Delirium is an abnormal mental state, not a disease. Although the term has a specific medical definition, it is often used to describe any type of confusion. Documentation Minimum standard of documentation Identification of at risk patients Recognition of clinical indicators (including falls) in at risk patients MMSE/AMTS in all patients over 65 Use of CAM in diagnosis Document diagnosis of delirium in medical notes Active exclusion of common precipitants Treatment plan QTc prior to antipsychotics Falls risk assessment and management strategy Document delirium in EDL Discharge MMSE/AMTS References  HYPERLINK "https://www.nice.org.uk/guidance/cg103" https://www.nice.org.uk/guidance/cg103  HYPERLINK "https://www.rcpsych.ac.uk/mental-health/problems-disorders/delirium?searchTerms=delirium" https://www.rcpsych.ac.uk/mental-health/problems-disorders/delirium?searchTerms=delirium  HYPERLINK "https://www.guysandstthomas.nhs.uk/resources/our-services/acute-medicine-gi-surgery/elderly-care/delirium-adult-inpatients.pdf" https://www.guysandstthomas.nhs.uk/resources/our-services/acute-medicine-gi-surgery/elderly-care/delirium-adult-inpatients.pdf  HYPERLINK "https://www.sign.ac.uk/sign-157-delirium.html" Scottish Intercollegiate guideline network SIGN 157  HYPERLINK "https://www.bmj.com/content/325/7365/644" BMJ     Guideline: Delirium Prevention, Recognition and Management in Elderly Review Date: December 2022 PHARMACOLOGICAL TREATMENT Medications should be considered only after failure of behavioural approaches and treatment of underlying cause. Major indications for sedation: To carry out essential investigations Prevent danger to self or others Relieve patient distress )GPghi   & ' K L k l = > ? H I J k ܮ{pehV,hqpCJaJhmUhqpCJaJhV,h^#CJaJhV,hqpCJaJhV,hV,CJaJhV,h/CJaJ hV,hqp)hV,hqpB*CJKHPJ^JaJph0hV,hqpB*CJPJ\^JaJnH phtH 0hV,h/B*CJPJ\^JaJnH phtH hV,hqpCJaJ%hi\L$f&@#$/Ifgdqpkd$$Ifl0#   t 6@f0644 laytqp$f&@#$/Ifgd/$f&@#$/IfgdxX|ll$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqp|l\$f&@#$/Ifgdqp$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqp  |ll$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqp  & |ll$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqp& ' > K |ll$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqpK L ] k |ll$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqpk l > |lXXXXD & F*$f&@#$/IfgdxX & F*$f&@#$/Ifgd^#$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqp> ? H I |ll$f&@#$/IfgdxXkd $$Ifl0#   t 6@f0644 laytqpI J v |llZZ$f&@#$/Ifgd/K$$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqp pp$f&@#$/Ifgd/K$|kd($IfK$L$l07+2 t0644 laytxX pp$f&@#$/Ifgd/K$|kd$IfK$L$l07+2 t0644 laytxX 5 pp$f&@#$/Ifgd/K$|kd4$IfK$L$l07+2 t0644 laytxX5 6 8 pZ$f&@#$/7$8$H$Ifgd/K$$f&@#$/Ifgd/K$|kd$IfK$L$l07+2 t0644 laytxXk l - . V W X m n o > ? ؿؔ}iR,hV,hmUCJ,OJPJQJ^JaJ,nH tH &h^#CJ,OJPJQJ^JaJ,nH tH ,hV,hluCJ,OJPJQJ^JaJ,nH tH jhV,UmHnHuhV,hqpCJOJQJaJhV,h/5CJ\aJhV,hqp5CJ\aJhV,hqpCJaJ hV,hqphV,hqpCJaJhV,hqpCJaJhV,h/CJaJ pZ$f&@#$/7$8$H$Ifgd/K$$f&@#$/Ifgd/K$|kd@$IfK$L$l07+2 t0644 laytxX T pZ$f&@#$/7$8$H$Ifgd/K$$f&@#$/Ifgd/K$|kd$IfK$L$l07+2 t0644 laytxXT U V W rr$f&@#$/IfgdxX|kdL$IfK$L$l07+2 t0644 laytxXW X m n |ll$f&@#$/IfgdxXkd$$Ifl0#   t 6@f0644 laytqpn o  |ll$f&@#$/IfgdxXkdV $$Ifl0#   t 6@f0644 laytqp |dT$f&@#$/IfgdxX$$f&@#$/7$8$H$Ifa$gd/kd $$Ifl0#   t 6@f0644 laytqp *|ppppddXdd dd[$\$gd`H dd[$\$gde dd[$\$gdOkd^ $$Ifl0#   t 6@f0644 laytqp *4?M\mnz~~hR58hO5>*B*CJOJPJQJ\^JaJnH phtH +hmUhKCJOJPJQJ\aJnH tH +hmUhB CJOJPJQJ\aJnH tH +hmUhCJOJPJQJ\aJnH tH +hmUh`HCJOJPJQJ\aJnH tH +hmUheCJOJPJQJ\aJnH tH +hmUhOCJOJPJQJ\aJnH tH +hmUhe5CJOJPJQJaJnH tH %hmU5CJOJPJQJaJnH tH *5?Mnz{|}~gd-qgd-q $a$gd-q dd[$\$gdȰbD+1hmUh-qB*CJOJPJQJaJnH phtH :hmUhE\5>*B*CJOJPJQJ\aJnH phtH :hmUh-q5>*B*CJOJPJQJ\aJnH phtH /hmUB*CJOJPJQJ^JaJnH phtH /h/B*CJOJPJQJ^JaJnH phtH /h^#B*CJOJPJQJ^JaJnH phtH /h-qB*CJOJPJQJ^JaJnH phtH >h&hO5>*B*CJOJPJQJ\^JaJnH phtH $Fgd-qgdE\dhgdmUgdmUgd-qծr`K6`K)hV,h&B*OJPJQJnH phtH )hV,hmUB*OJPJQJnH phtH #h&B*OJPJQJnH phtH )hV,hE\B*OJPJQJnH phtH )hV,hmUB*OJPJQJnH phtH #hE\B*OJPJQJnH phtH #hmUB*OJPJQJnH phtH )hV,h<B*OJPJQJnH phtH )hV,hE\B*OJPJQJnH phtH )hV,h-qB*OJPJQJnH phtH  ɰpY@*+h`HB*CJOJPJQJaJnH phtH 1h/h`HB*CJOJPJQJaJnH phtH -h/h-qB*OJPJQJ^JnH phtH -h/hmUB*OJPJQJ^JnH phtH hmUB*PJ^JnH phtH 1hmUh8 B*CJOJPJQJaJnH phtH 1hmUh-qB*CJOJPJQJaJnH phtH 1hmUhE\B*CJOJPJQJaJnH phtH :hmUhE\5>*B*CJOJPJQJ\aJnH phtH  gd-q '(B*+Fij¬–r`Pr`Pr`Pr`Pr`Pr`Pr`hV,hE5CJOJQJaJ"hV,hE5CJOJQJ\aJhV,hECJOJQJaJ(hV,hEB*CJOJQJ\aJph+hV,hE5B*CJOJQJ\aJph+hEB*CJOJPJQJaJnH phtH 1h/hmUB*CJOJPJQJaJnH phtH jhmUUmHnHu+hmUB*CJOJPJQJaJnH phtH gdEgd-q $IfgdxXgdE  'i`` $IfgdxXkd $$Ifl0`' `` t[[0[[[[M,644 lap[[ytV,'(Bxoo $IfgdxXkd $$Ifl0`' t0[[[[M,6[[[[[[44 lapytV,xoo $IfgdxXkdv $$Ifl0`' t0[[[[M,644 lapytV,*xoo $IfgdxXkd $$Ifl0`' t0[[[[M,6[[[[[[44 lapytV,*+Fixoo $IfgdxXkd $$Ifl0`' t0[[[[M,644 lapytV,ijxoo $IfgdxXkd$$Ifl0`' t0[[[[M,6[[[[[[44 lapytV,xoo $IfgdxXkdb$$Ifl0`' t0[[[[M,644 lapytV,wnn $IfgdxXkd$$Ifl40`'` t0[[[[M,6[[[[[[44 lapytV,EGHIM  *+,8RSWYam$¤¤yyyyyyjjhV,h<CJOJQJaJ(hV,hEB*CJOJQJ\aJph+hV,hE5B*CJOJQJ\aJph:h/hE5>*B*CJOJPJQJ\aJnH phtH h/hECJOJQJaJjhV,UmHnHu"hV,hE5CJOJQJ\aJhV,hECJOJQJaJ)wnn $IfgdxXkd$$Ifl40`'  t0[[[[M,644 lapytV,wnn $IfgdxXkd$$Ifl40`'  t0[[[[M,6[[[[[[44 lapytV,EFwnn $IfgdxXkdf$$Ifl40`'  t0[[[[M,644 lapytV,FGIJKLMa{wrkkkkr^^^  & F'dgdEgd-qgdEkd $$Ifl40`'  t0[[[[M,6[[[[[[44 lapytV, $ +,8=GOZ`Ff9 $IfgdxXgd-q  & F'dgdE`akdS$$IflֈK q#On1 t0[[[[$6[[[[[[[[[[[[[[44 lahp<ytV,amr| $IfgdxXkd$$IflֈK q#On1 t0[[[[$644 lahp<ytV, $IfgdxXkd$$IflֈK q#On1 t0[[[[$6[[[[[[[[[[[[[[44 lahp<ytV, $IfgdxXkd$$IflֈK q#On1 t0[[[[$644 lahp<ytV, # $IfgdxX#$kd$$IflֈK q#On1 t0[[[[$6[[[[[[[[[[[[[[44 lahp<ytV,$/4>FQV $IfgdxX$/HPWb] qX::h/h.C>5>*B*CJOJPJQJ\aJnH phtH 1h/hE\B*CJOJPJQJaJnH phtH 1h/hE\B*CJOJPJQJaJnH phtH 1h/h-qB*CJOJPJQJaJnH phtH :h/h-q5>*B*CJOJPJQJ\aJnH phtH h/hECJOJQJaJhV,h<CJOJQJaJhV,hECJOJQJaJ"hV,hE5CJOJQJ\aJVWkd$$IflֈK q#On1 t0[[[[$644 lahp<ytV,Wbgqy $IfgdxXgdEkd$$IflֈK q#On1 t0[[[[$6[[[[[[[[[[[[[[44 lahp<ytV,*2^ &Gp & FdPd[$^gdn?gd.C>gd-qgdE\gd-q $w78淞p[E,1hmUhn?B*CJOJPJQJaJnH phtH +hmUB*CJOJPJQJaJnH phtH )h/hn?B*CJOJQJ^JaJph)h/hn?B*CJOJQJ^JaJph1h/hn?B*CJOJPJQJaJnH phtH 1hmUh.C>B*CJOJPJQJaJnH phtH +hmUB*CJOJPJQJaJnH phtH 1h/h<B*CJOJPJQJaJnH phtH 1h/h.C>B*CJOJPJQJaJnH phtH  OUHu8 & FdPd[$^gdmU & FdPd[$^gdn? & FdPd[$^gdn?dhh[$\$gdn? & FdPd[$^gdn?Hp !L"M"""#V#### & FdPd[$^gd-q & FdPd[$^gd& & FdPd[$^gd-qdPd[$^gdmU & F+dPd[$gdmU dhhgd-qgdmUgd-qPop !!K"L"M"U#⫒|cGcGcGc|.1hmUhmUB*CJOJPJQJaJnH phtH 7h/h.C>5B*CJOJPJQJ\aJnH phtH 1h/h.C>B*CJOJPJQJaJnH phtH +hmUB*CJOJPJQJaJnH phtH 1h/h-qB*CJOJPJQJaJnH phtH 1hmUhE\B*CJOJPJQJaJnH phtH :h/hE\5>*B*CJOJPJQJ\aJnH phtH :h/h.C>5>*B*CJOJPJQJ\aJnH phtH U#V##F$G$&&&&&&Ӻy`B)1hmUh&B*CJOJPJQJaJnH phtH :h/h&5>*B*CJOJPJQJ\aJnH phtH 1h/hmUB*CJOJPJQJaJnH phtH +hmUB*CJOJPJQJaJnH phtH +h&B*CJOJPJQJaJnH phtH )h/h-qB*CJOJQJ^JaJph1h/h-qB*CJOJPJQJaJnH phtH %h/h-qB*CJOJQJaJph1h/h&B*CJOJPJQJaJnH phtH  # $($F$G$w$$$ %%%<%c%}%%%%%%& & FdPd[$^gd-q & FdPd[$^gd& & FdPd[$^gd-qdhh[$\$gd-q & FdPd[$^gd-q&&&&&&&'''''))4)L))))gdmUgd.C> dhh^gdmUgd.C>dPd[$^gdmU & F,dPd[$gdmU & F,dPd[$gdmUgdmU dPd[$gd&&$&%&&&&&&&&%'&'''6''''ʱʱʛfMf41hmUhmUB*CJOJPJQJaJnH phtH 1hmUh&B*CJOJPJQJaJnH phtH 1hmUh-qB*CJOJPJQJaJnH phtH 7hmUh-q5B*CJOJPJQJ\aJnH phtH +hmUB*CJOJPJQJaJnH phtH 1h/h&B*CJOJPJQJaJnH phtH 1h/h-qB*CJOJPJQJaJnH phtH 7h/h-q5B*CJOJPJQJ\aJnH phtH ''))))))*+ɴoV=$1hmUh<B*CJOJPJQJaJnH phtH 1hmUh.C>B*CJOJPJQJaJnH phtH 1hmUhmUB*CJOJPJQJaJnH phtH +h.C>B*CJOJPJQJaJnH phtH +hmUB*CJOJPJQJaJnH phtH 1h/h.C>B*CJOJPJQJaJnH phtH (h/h.C>CJOJPJQJaJnH tH 1h/h.C>B*CJOJPJQJaJnH phtH :h/h.C>5>*B*CJOJPJQJ\aJnH phtH  )))**(*@*v***F+}+++,-- & FdPd[$^gdQj dhhgdQj & FdPd[$^gdmU & FdPd[$^gd-q dhhgd-q & FdPd[$^gd.C> dhhgd.C>++"+:+D+++6.7.I0V0^0ʹgLg7.hmUhn?5CJOJPJQJ\aJnH tH (hmU5CJOJPJQJ\aJnH tH 5hmUhQjB*CJOJPJQJ^JaJnH phtH 5h/hQjB*CJOJPJQJ^JaJnH phtH 1hmUhmUB*CJOJPJQJaJnH phtH 1hmUhepB*CJOJPJQJaJnH phtH 1hmUh-qB*CJOJPJQJaJnH phtH 1hmUh<B*CJOJPJQJaJnH phtH 1hmUhQjB*CJOJPJQJaJnH phtH  -..7.Z/I0^0%1t1~111112D2x2222!44 dhhgdQjgd-qgdQjgdmUgd-q  & FdhhgdQj & FdPd[$^gdQj^0f0T1s1t1}1224#5)555ѿѡsZ?!?!;h/hQj5B*CJOJPJQJ\^JaJnH phtH 5h/hQjB*CJOJPJQJ^JaJnH phtH 1hmUhQjB*CJOJPJQJaJnH phtH (hmUhn?CJOJPJQJaJnH tH 1hmUhQjB*CJOJPJQJaJnH phtH :hmUhQj5>*B*CJOJPJQJ\aJnH phtH "hmUCJOJPJQJaJnH tH (hmUh-qCJOJPJQJaJnH tH 1hmUh-q5>*CJOJPJQJ\aJnH tH  4#55b6n7o7q77a8?9:;;<N= & Fd-D9DM gdmU & Fd-D9DM gdmUd-DM gdmUd-DM gdmUdgdmUgd-q & F-dPd[$gdmU dhhgdQj5b6n6n7o7p7q77N=O=]==䯘jU@'1hmUhQ 5>*CJOJPJQJ\aJnH tH )hmUhQ 5>*CJOJQJ\^JaJ(hmUhwCJOJPJQJaJnH tH (hmUh-qCJOJPJQJaJnH tH 1hmUh-q5>*CJOJPJQJ\aJnH tH ,h/hyCJOJPJQJ^JaJnH tH ,h/hn?CJOJPJQJ^JaJnH tH ;h/hQj5B*CJOJPJQJ\^JaJnH phtH 5h/hQjB*CJOJPJQJ^JaJnH phtH  N=O=]====>)>Z>>>>>>?????z?<@JA  & FgdVegdE\gdmU  & F)dgdmUd-DM gdmUdgdmU-DM gdw= ??????Q?R?x?y?z?{???:@;@<@=@д|fK|f05h^#hE\B*CJOJPJQJ^JaJnH phtH 5h^#hQjB*CJOJPJQJ^JaJnH phtH +jhxX0JCJPJU^JaJnH tH (h^#hVe0JCJPJ^JaJnH tH hxXjhxXU-h^#hQjB*CJPJ^JaJnH phtH 6h^#hQj5>*B*CJPJ\^JaJnH phtH  hmUhmUCJOJQJ^JaJhmUCJOJQJ^JaJ hmUhQ CJOJQJ^JaJ=@@@HAIAJAKAAAAAAAAAAAAAAAABBBBBBjBɮ~~cXPLPLPLPLHh/hhjhhUh^#hCJaJ5h^#hE\B*CJOJPJQJ^JaJnH phtH 5h^#hQjB*CJOJPJQJ^JaJnH phtH (h^#hQj0JCJPJ^JaJnH tH 5h^#hVeB*CJOJPJQJ^JaJnH phtH +jhxX0JCJPJU^JaJnH tH (h^#hw0JCJPJ^JaJnH tH jhxXUhxXJAAAAAAAABBBBBBOBjBkBlBmBBBC>C_C  & F&dgdEgdEgd/gdgdE\  & FgdQj  & FgdVejBkBlBmBByCzC{C|Ch^#hCJaJh |hE56>*hEhhhxX_CxCyCzC{C|CgdgdE  & F&dgdE21h:p/w|. A!"#$% F ˜v.= 1 ExifMM* '(1"2ևi$-'-'Adobe Photoshop CC 2017 (Windows)2017:01:12 16:17:120221yrz(HH Adobe_CMAdobed            Y" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RI$I%5:Q[\d{Cy`3b{ 漎Cjcە﮿?k[zv~{ha'Yw=Zŏ,Ru&O~8DbcM[i0Ř$H1bt7{q3\}¦zU˰zD9qn[߸U+YA+] n+k~Ym/Oc./gq$L #$>ɝ'ݱ۽],k1syc7#i/?e,kvdNVv^MP汕W1̐-ۼ7) x)>Q̩O8 bW.R-~Y1|[#HOE.Y)8Tk鶊e}:^N/jk+mÞƝ~b9ˆ@.)F+IE86mݚ ]?ѹ\ @0^GoOժ>tdTސs^ok7g[ֻzZ΂O٨}5Q>/?ǥie` \>|-(L~-Ϯ?ZrᲫ,} ick龿Ybgtպ^E@.dFb_Z{s_]?Fv'YDXz=Ӎc*'Vv~8q% #2#'?lǂzy^Fv]N5Y]>de=z7JʧGB0:.c~tq~;kgau_Xc6zy5XX1ߍҾU-ͺ, 6~"9O!C9 b@$Hlh@Pۀ;+K~~1e1%ti'vrBYA5e"c"@TI%)BE4qk+iyk4S;/7=/wn>Dügٶz_.NS>~ ٌufb}K$}`GP+yRSM2`tMֻ' ѹgzۨ~عNվddeb_F-vXkY?3oVQgk,c>=+^б|HVY_V?X:`4_a[-\_t,0mö-mo!Wߥ_NϠW0.\eurqZ c} uζmi)>^659ֻh(cuP- ?N2lfn[~lq}c}tue; ukc]S_2- v0tTN%9k'9bJ{ԗ2nV~]K' 0s)`{uq-US#~uѮ&Usf=UY~\OOU-J{ӫe6[ciw.WUmj'f}E~Eݟ^=}F_K{?=SI2aU/&ݔFE&kvO]{m~ /,=O}](ο#_Xs}[YCes=l?#l̆u/^׽:k-^];_g쮽m)B'Xme-kXm*JT*qk[$=p-8E^auGk"GSۋpO]i)򱭨]}-5GҗچΧӬf%y5?&zk\gƃpkniоYŷWhU]ytO8$QA 9^9[({;=)?Fs~.}kA;:Gٌԭnˤk+;?S>[ ָz8&UQcWo׵rMOo?^ͯ_H{15ٙ/_}8_oIY%;+ecR+,vU^kHq-nƻn<~Һv>Hʷ׷!9z݌[x=Pg)ؖfPpuRJ_-^:ϟwE ʢL}V.~?FG+߁ѱq(u?YeelggozW-tAmqu ~Sj־AgP ]nEoȰ>c-]^b׾>nU]Y"*e,s.폳{SuSV7\0@n[Sk{7e~E]O3*V}!N9>k57m[-]s6N3z-(cgX3}Oclk?lYz߬OWnN-xcg9Y[Wo%=}+tN݅i饮vmR~.oF][''t^b: Լ1~#]/Jo!XbgINOjozXM[[e{=އw]a\ʦ;WZ{Y%>}A'=f_U8X_^U[}9cCmf&*^_~xơfXvM`X+^bJw[[z30gMf;w7sk,kgٺH7Qr:7wU?##Zvg.£7|1}uzeeVWʽ6TM?cs&RZ^ʘr.e }^W]^OSJzo =c}YY.nev_ٱIk.oZ=W6+gLͻ)2N5%?UuϩTu8]mo잗ւۅaw=t$RlN1}'Ym},{V-'`?{6zfŰ>guL1:XݾY]We?!sh['B&R/ȑ]G2ތ+er1zEΥٺsK=\v쭞]߬YR3>e?_zoUWWPc*=MƺcHdh/~F%ަU^;*Ⱥ3o,{K̶1N QCk1nnUjoӋ:sFRn^7O-qgCv[鉰:.wg)X}rNF+q>ϴ@gOاҳGH}fs=iwkj7_n:^^c3s>^6;3 6'k+e_M4aoMqx:/t~}[f<tM6ˀe̳o|nOxVu;w\}6}k[cϰ[k쭍~~ŷdٓf%.kvWA׷꭫gbɀEz`dc?ԱGgu_WFgTDm"}V6]z[v,kzY7u E ve;zoiu?nKƵّ4 a>c}ΊG#6XcZ>9}},qhr7i8>:+Ywzlm[˶ڹoa՟neZlL~xXFS}VݺNzͻzA؟YU9nm 0e}Zkz+)`/A#;5mԱXJZr2Ey,7۷WmVZ)ֻni6WYcv7sI?Hv;,~-y'=s\{[in1 *qP)\zI 2$D:qUev[T:VO՞2\ 匥ެܜ+nïK2?ZT|:qn,Gn͈}?9NkoU3擲~ksDo5f/smm7WCڲY c'#ja[;8\ovyv?~͟Mk,o_u7gvPLYc}*Y__?S' mS !TI%)W&kvjqc~׫ #7T|\t5-Chk6Fne{#uX zq}Z))Oz_WӇ8xoĠ;es.szn}- ]6~I7_O }8\3)km}^ns},}.'@g5Ayt7%ܴN>kVoޕu8RVS];w9-祽hݑK \+6mzxV~ϡk$rME~ r5o;Y.~qۓQ6>1*u}9ȫRC~j|CҸwZ CcQ.'oo~l3,c2@vWsMVL>Gqݮ׆ gΞ\fڿf[ַozmelN>3_x!]8[gҳӹRR~J֟j_M,.\MbwUu$SU N Photoshop 3.08BIMZ%G8BIM%}Ǿ pvN8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjc Proof Setup proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMIy CMYK BLACKynullboundsObjcRct1Top longLeftlongBtomlongyRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongyRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Y Adobe_CMAdobed            Y" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RI$I%5:Q[\d{Cy`3b{ 漎Cjcە﮿?k[zv~{ha'Yw=Zŏ,Ru&O~8DbcM[i0Ř$H1bt7{q3\}¦zU˰zD9qn[߸U+YA+] n+k~Ym/Oc./gq$L #$>ɝ'ݱ۽],k1syc7#i/?e,kvdNVv^MP汕W1̐-ۼ7) x)>Q̩O8 bW.R-~Y1|[#HOE.Y)8Tk鶊e}:^N/jk+mÞƝ~b9ˆ@.)F+IE86mݚ ]?ѹ\ @0^GoOժ>tdTސs^ok7g[ֻzZ΂O٨}5Q>/?ǥie` \>|-(L~-Ϯ?ZrᲫ,} ick龿Ybgtպ^E@.dFb_Z{s_]?Fv'YDXz=Ӎc*'Vv~8q% #2#'?lǂzy^Fv]N5Y]>de=z7JʧGB0:.c~tq~;kgau_Xc6zy5XX1ߍҾU-ͺ, 6~"9O!C9 b@$Hlh@Pۀ;+K~~1e1%ti'vrBYA5e"c"@TI%)BE4qk+iyk4S;/7=/wn>Dügٶz_.NS>~ ٌufb}K$}`GP+yRSM2`tMֻ' ѹgzۨ~عNվddeb_F-vXkY?3oVQgk,c>=+^б|HVY_V?X:`4_a[-\_t,0mö-mo!Wߥ_NϠW0.\eurqZ c} uζmi)>^659ֻh(cuP- ?N2lfn[~lq}c}tue; ukc]S_2- v0tTN%9k'9bJ{ԗ2nV~]K' 0s)`{uq-US#~uѮ&Usf=UY~\OOU-J{ӫe6[ciw.WUmj'f}E~Eݟ^=}F_K{?=SI2aU/&ݔFE&kvO]{m~ /,=O}](ο#_Xs}[YCes=l?#l̆u/^׽:k-^];_g쮽m)B'Xme-kXm*JT*qk[$=p-8E^auGk"GSۋpO]i)򱭨]}-5GҗچΧӬf%y5?&zk\gƃpkniоYŷWhU]ytO8$QA 9^9[({;=)?Fs~.}kA;:Gٌԭnˤk+;?S>[ ָz8&UQcWo׵rMOo?^ͯ_H{15ٙ/_}8_oIY%;+ecR+,vU^kHq-nƻn<~Һv>Hʷ׷!9z݌[x=Pg)ؖfPpuRJ_-^:ϟwE ʢL}V.~?FG+߁ѱq(u?YeelggozW-tAmqu ~Sj־AgP ]nEoȰ>c-]^b׾>nU]Y"*e,s.폳{SuSV7\0@n[Sk{7e~E]O3*V}!N9>k57m[-]s6N3z-(cgX3}Oclk?lYz߬OWnN-xcg9Y[Wo%=}+tN݅i饮vmR~.oF][''t^b: Լ1~#]/Jo!XbgINOjozXM[[e{=އw]a\ʦ;WZ{Y%>}A'=f_U8X_^U[}9cCmf&*^_~xơfXvM`X+^bJw[[z30gMf;w7sk,kgٺH7Qr:7wU?##Zvg.£7|1}uzeeVWʽ6TM?cs&RZ^ʘr.e }^W]^OSJzo =c}YY.nev_ٱIk.oZ=W6+gLͻ)2N5%?UuϩTu8]mo잗ւۅaw=t$RlN1}'Ym},{V-'`?{6zfŰ>guL1:XݾY]We?!sh['B&R/ȑ]G2ތ+er1zEΥٺsK=\v쭞]߬YR3>e?_zoUWWPc*=MƺcHdh/~F%ަU^;*Ⱥ3o,{K̶1N QCk1nnUjoӋ:sFRn^7O-qgCv[鉰:.wg)X}rNF+q>ϴ@gOاҳGH}fs=iwkj7_n:^^c3s>^6;3 6'k+e_M4aoMqx:/t~}[f<tM6ˀe̳o|nOxVu;w\}6}k[cϰ[k쭍~~ŷdٓf%.kvWA׷꭫gbɀEz`dc?ԱGgu_WFgTDm"}V6]z[v,kzY7u E ve;zoiu?nKƵّ4 a>c}ΊG#6XcZ>9}},qhr7i8>:+Ywzlm[˶ڹoa՟neZlL~xXFS}VݺNzͻzA؟YU9nm 0e}Zkz+)`/A#;5mԱXJZr2Ey,7۷WmVZ)ֻni6WYcv7sI?Hv;,~-y'=s\{[in1 *qP)\zI 2$D:qUev[T:VO՞2\ 匥ެܜ+nïK2?ZT|:qn,Gn͈}?9NkoU3擲~ksDo5f/smm7WCڲY c'#ja[;8\ovyv?~͟Mk,o_u7gvPLYc}*Y__?S' mS !TI%)W&kvjqc~׫ #7T|\t5-Chk6Fne{#uX zq}Z))Oz_WӇ8xoĠ;es.szn}- ]6~I7_O }8\3)km}^ns},}.'@g5Ayt7%ܴN>kVoޕu8RVS];w9-祽hݑK \+6mzxV~ϡk$rME~ r5o;Y.~qۓQ6>1*u}9ȫRC~j|CҸwZ CcQ.'oo~l3,c2@vWsMVL>Gqݮ׆ gΞ\fڿf[ַozmelN>3_x!]8[gҳӹRR~J֟j_M,.\MbwUu$SU N8BIM!]Adobe PhotoshopAdobe Photoshop CC 20178BIM http://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$]moniO<IK$5ʺfn]ח}~lmOD0I#KvҊJ+1I uu%z:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{UUMEO5]eDSU4tFM+$qbP< 3ƁTId1H'u`fO,n"=qJG~ڳ? >oA}gxEiØnb<-a#G==MAdF(?˯{H/oϏ` v݌voT&gG揄Ge+W{aN_SqGGt6rIT}GGfrZ/kkVmbAɶ l=اcزjeyHl?-A/ee=}$>:Y%Ᏸݝ݄m}k$7 dVFj~ΆvV,w1I{ۇ?׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{EvVn݉3alӼFІkuAઘ(Z*7)]ĩ7s.r7Tk ) M#%={%=k'[Un< *g@X!6yGmz[3EPEt|y'|3J|iY$^{wB\V˟`=3`߿w9=З3վZ0Y`߿w9Hn=ǻ՛[vnOk鲹^=xꪥn:Ɛi_zko67{+_Y;PI <4rܓsӾwss+nژfB|zW{c]{{uNMݛ5?7uvػ17To*:| Ep(j4Ĵ1 (= {g~r7-]lVyc+41iR,jc_3㙹yy[[XV'J5XH;{}.g}?\F /CsIAuk쮽v_7{*Ǹ- 9 ;"ZG**74]l?MOX"x^S^DeNdN_}/`ZM%uO*?uD*:lu&>? %-=,@bH 3frI61q vr59:ډ ;"}rI1 {rx-/;Eݷxh f€*.aw{$5ӗbĉf ,I{ٻK`d{/}4-mu9lQy){sN5Xج0hZY BH|mʼ{H55;c0@igDf"PʦZ~On6 d ;M0+$G b$CEQ 1TVazz}kr8*ڞ m՛nrpR+Zi!a+uo }dw41JK 0AN<3Xͳԁ<^8©+t^>u+Loכӳ袦VSP@D4[P&m9C)Kkx'3"r|ى$zb>n4s515JPB{ : u~׽ߺ^x|eVܻ?-SSkr"Mԥn&Je[űYo51̇Yteo;p.mpxex>i/*廂^-=]1{o ;<}zI#3y2pXvT(j]lnO#>?Qyryfb-aUP o3$ hi:y,tssw3na1^_$\$Qk#E kvG+O{>؟}մ}Y[':u[ ~Ku~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{_gt< n,j Su laʿ֟O",k>_M Or~^cbȤnoViQ(uzuz9{]{߽u~׽ȤZZ*j*vzjyh'D!P27_SC2)VR*XP<yY`9ᐤ AȃzƮۦxM6{'|TZ 63~rdܓ*n<1šL7!1}{o͑s!r7F2RL%z^~{CcQ4[7C.ޏ?[Gq0G-.{5ivD{5H?i39[1,n^3 ?(׽r_Q^|?O[/?p2谛; Y5?[ck90d0Ab ̪x>_?߹ۊIo4$:Z?5I.?W.Z=ţ TY\ī,^D~@v$um[zMV; U+ௗpW->9d_y?Qb?ꗵ+&G핐u=Jp{u\)y"qv>Lm܍N {}>8\ڮ9ZsG_ϭn?L(q1:ߺ.Xx[Y4o"s/׽u~׽ߺ^sItڡPoSMVU#'чݏ[4z&m;aK^8oO)~imI%ܞK@GȬ!k׽sP^*%[GJU=4CTuRFڒi lO \H4,x*% =;2 Zy*ij>duD=K6|}%K=xz Y)wikKQY€^F6]?r;߹z|M52' 8ݶ-ێ@.VccY$<+Hzɧ~g{-3sk1?=f/3TݧyY"IQQeREQ{ .{\ĒorwNwC% &MdyG\w2YW P`N.#U}m"{{UK; 33*I<z$(,ƀu Rz ln*rF"ꄂNӽl3[+5tm;]cl?m:#x6*Ȭ>2يF2VF*C |=ۭu{)>B_hqwԚdRujEѱ1HߦR ;o>gӶÜ-,ݽzC~ύuոK~/qR uf[V]}~o=A+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{[_g~=u=EpZdk8z]eUɽ+QzvN?_|~c/dVQ724Qk ~N:QL]vA?ĴJz]=cu~׽ߺ^~{kOWUr1fӗ7;DF:ͻE?Kq{4vl{PlP'1i4w飯.׺@]msqvj^ -K#-֛5{#oU|_I|i#risݚv$0?/Tup\~h:ŷ I._^g?? jv5*gVx&/ %nY)b{~gPx''w+-H͵]\x % f+s#dks-&ҒR]r2cϯ{[rz^~{NSk>w[ͽ&1MĦG!gQcOOʞrdrfp,1Pu_.[(mP[LO_^io|{߽uhޔ]o;2z?l-~ Wg* 0PϳUخ9sm+[SR%n:&M\niS=xi&!fyNwe2y 䩮w?yYP6v65pTE |uus=̅e,ijO^ڎ/Ovzn|1]Qa~i£GzX۟pO?{,&LFb[ZDGI:Kronvsy3#nRz?/kWl#gꞞ{l;kO޹rqnU*VpNO}yh6M{)k8T$&@F@=tS>~赔۾ S@gд15r n׽ߺ^kc#bzAYQvgE^N Q uH0ս4?"GA#:/JyCBsv43qo gQFHë B{){ͻ4k~X"XY13 sT{KQ=_[`PR -9gymy%YZē<|ΗRso5;õIP>JTªun^R;x9cl Q@ 8UC1>lĒrI={ؙ)Г{Gn޼HclC"v.x7QVBo+og{/3s'.L.y{/.ki偁νnܿo7ݎ(VxciI:|m][YSr' +}NGp8?eIE5E~rF{a|BŐc[1OIWOXοt/eT{5bw_~, 67RCAPcq4㧢:Z:HpĨ{ī뫛ɚKgwl;bIj ;k{KXv"(UPT |G+O{>b7ViGӠWЧ|^'^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{OOf҂GԽosBfa p۾-uSʟ}ra d;OEl}eNO~<ޙ;u<Vn]{؛ҽ}7lwU|Q'bv.ZXcX,bƐQT>œ̉ɼ&;fuuC!yB$ %́[ ڣJbkR{}WNZڱTN^TAʀk/Fl.a۞oCu". FH{{I>i+6dG"7$M.>L:Ӡ^p?'ѧ ]WnycRD7~٫~Eu8>|a7ߑ^6 nH~uTP9s,߼pl˦z؂{|dQ Ŀ9i׽g=v+{S_[  ޻iYL1}-JNʞ?9HycxAX]7|1hėHu|bndm}i\-Oɏ^u~׺?[v>)nĩvke>}68?Eøj2'?9f)+o=ԏ+Vu֯.~z #O6Ѥi%3{<vG﯎EFjnS+mٗX)[UٹCi=Ϳݭ/{ΒG[YFޟOO(龦D?bwoJ9?ǯ"?~Z={޺^w<{^EqcW'Wݥ =I]-6mōTj*|ȲS0^C%ahJK9{?kE4 uϸ.rm㤻q/{4ȵNj_s>W}$U^#eW׬ussخvtMEh?Q8/J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{s)*>vvK_!혃܇mJh<8*R}Z=(%y>s3ϯu_="ɪ?#,#P~]{y%v}z ꊉ׸ع%ӨGnV0؄}לǽXX}gs_w^q$umd?uQSL{ܫ#Ǫo^,'#tF O#%Mm@M 6K3H7'w=X}y6mWʫ\[S}s8(97;o5-7,iL2mIO7 VT__vb3}{ŀ5mf(RԞ9Y${w-s*')CCrLV^ Je7_^Yl{{6ʯ1?b|ݙl^޸ **cb1YZ 4gơ员ݘ^Ơ>gi E/$3 Q4U`G^uѱ{YP# ۘ@X$UZ4I9'{R+o_wWeZz1^xsno^w>eW|ؿ{wWeZz{Scw[z7`88vhm6ܧ{v49ZX*Qcsj44 RW[nMv@vѢ1,1Vd/hIZЕRE@6gmqۖA y8I$e 0 J׽]z{^^ӞFfӥ>'6uO UqqxAC_'!rV-ibi}=z#~Ϛ:I$ }R S׽g'n^iVW^Q(L`[PʟwQ9 9ԽٴMn7o(Oa8ez|4pu<}=Kڝe!׿:Z/`bҖ$#!&{FjJIਦ) VXfU*2 X9^PAVR*#FRG$2I ѲJC)A9{Ω׽ߺ^!mMn8woTێ Wi+֒hP9t ,C!ajS睭nq=kjI(Rq5QǓWA-g3rv⛷*{~?4dm$SOg.;gd{So )v`SVVaTl"a<)$ҷ{ܙ%N.Ϲgc/u՘zz_n><ٴ;,{76`͚<[}Esï{>MMTͯUBJ=ɶDYL\MRcfYPjs='>rs=|)pNAYA%@:臷GO~LbiGO 4-GCQJ3^u~׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]/6wfGVlެ޹|<SYۅ^C秦/{_뿺~G 9i~΀~GێxUL{]̑oP~}{#_?{߽u{|:Ȯڞ #]bYӖܹb{X}q70LJEf)p.^wp [{D><4xL:_$9RyKk;[pHCsRF,HYc<>|Vynm;0XmBhQ/HvroߠUy@xGʲE+zuzl{?\{{{ݫ:7\=1s k&H2Lϭ)ٹ dnUx!x%o_u:6Sx71M!@uOi~[iYZ,%smtm<2~uG{??w>wx޴1ڣ}y[v+kEqe?5^S^+SnU]=cTBO.*zmѸ1S0?EXc…$=9ۘMlٶ>/-?=4̚<<\ |]Sƕ#媤^pŏ0,a'KnxRAWH{TH̳z&n$DEAT~׽g}UiOeWy>w޵"SymѸ2 xn{y^CVޞ۷[Z8REz^gcIn&k4%?-TbN:{^{{u׺{^{{u{wǜDǴfZ+ZlGycXzf)!_ώ%>yl{zjH]GI- 3r=E$j>J:z]`c;sX̉?E]Ư"]orԵXj#`Zvov\vn܅B EY_1TQo~;'Wɗ1m%ZU`Ehfo2+92dw|YWXM>ig50lƵ^c$Dk?nmn͖Pm1Wnf830}-\ՈIJ_:jLf|J{~${{uV^ߏ}5Sw` M+д^;sEc QK:n6A?rgp.s#n*ú7 ,/E*V"#*H"L^e,7I-whOkFOHd`A{ޟ7#m`giv`H3SɓG&YquPg=Y~|=ow;Mϓ7 Z}}En@ RaR{쿺gek &rPx`$D뫸0mK{hdunr?ūi~y?{hS>/J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]O#WkCQ;$Fv*BQk0̊H͏'+~wxͶ]]T"i8u}nc֒Rmp0^WN׺?]s 5]uP˦I1X&8T6cT>s\ߦRJų6y %x)q?%vGߺ=%w;)U`x$#ǯ{?muau~{e]rFq2UDTQז&2ȊAy?oy39kv?_tZ @-KIz.iNk`'Ynh2溵^{g1Nٻg3sm}TFmAZVҺx[ѵod&{m7G2,ߚ=|mͺn[>IU"r){.u{ ^]љ=h7{ i~*r{{rI<1/_\^C[f g]H9T_F>>ܑq- , NC{z=O]m~yMDq~윚#` }ۜ=XX}gswnp94nrXfY%=VL?:&~蜹aוx[mx/ &H<k/ gZwlc*iz|<5D&'O~휯qݍ ݢE1YP~F8~Wٟq&vK 1%-c#e#:=׺:Q @|Mv6mg!`EAǒWxw죩XO xypka-m ),d Ȅ׬&Xo\WʡpAu8!e7%{|&X{~sAu/_ ~d={߿Mx/vQ^- "zc^#½[7׿%'E@z; ~l?6^oQS *%< &*) wcjmw?le'/u,^WxQ.V$Hs@\L*hf,aؿz\Q(H U&d?׽];m<~l*+g249:ꪔq>˷d7MYK<"Fz_m6k[~lï{:-ٛWl:xSo*;Xl] i_J覥Qa[w[˙g9ُ_DVo{nfQ{P{-^~{Nww 'Sdu_kd!$FS=hvwRKr#z =%'ܬ⸱trFFX|#{SrCe=w:4mK`UV8%?l*X*ccs/k>>r;|&.N_]MsxKeo8%+mƻVoڱGt^]~EkLhUU YvRIu5z1UES5tDfC'Z=߹2xJͬ-ͫ%D Cʌѽ֎̿u}/gٹ|C5Dcb uYe[ܿ]׽ߺ^~28~O[笢pҳwu;A:b *̬ц9?uH v6= .k?pgn& .5ȴwj#O{^Z>h|ioۧܫO>fj>ߨOtⷹ{ϋҗ\{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]}vWo??O>;26Q흿4IK&|ܫ^.coO6`ҎOyc i$31^o׺κO/x>ַ Ի6ltxsO7*ۃVosϿ}/Ʋky5) 0Ӯ{5_j}Z=3CۙF%fwOԗ׽3z_yj*Ow'  h~i'nePg:^V 7zt^.%NtDDm,Qڜ]oO޽oG|Ʃ+#qZXޱ{{GgBv^LǷw#4DOckdQ;8Ժ~p;#fwPVr`X'^\"s%4lqYUr@O:Ǡ^~{_}SOfgukrӫK0G˿)jǒb-"AƸI뢟p\׹{Gq4`'{ٶ|ݑz[J5[63p A{mW̲[}fHOUz>\ڭ`JMuz_\{{o|ڪ%V[s}d?=ʹ>TRU84>Ex,iI:}򳮐~׽";z{< X}Bą2e0w!Y</J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{oy QcgVgE&zB~G$,?}_HF{>~eBH ۚהeT[[2#)$ $qjhTDEUUE-݉bjI$UT* 8׽׽?'HWyc<ޕ{G=4Ig]45=]\znmI@Kߩs9_?s3Rv[A86:G4ޢ^ o.JnweA)EM*8T?}{߽u~׽ߺ^Io7䚟Y|oE98bFVr?㵤ٶKAN `ho:g.~Fqx6stkJOʖڗzvG^O'*FSpE,q{^~ζyqܯ>s7%whԞ&;(C>^%܋ɜV; a%ܥH?=ѷï{o}:{^UKq#3ݣbV#.JI3+r8=M2rGQ'~boI&}ODU eOO]/c6[Lj:O1~3{I4ϹZ)̟PVO^GN׺@oolmZYn~1U]op9ްaG|v&횪~?,)qc&ucrTUQTQc"Ot. IȘM:[dnviUwT uVWWJ2[.n{c}73E Guv()TXZMU!Ϥ@x 5r,qnޟVU9܍_C6=ژnΔ?v=׶<[JnH=>9<mc#+hCm%HO`ᕾM;)OSKGg8O~*oː2 x˾}>,#T-hg " [#tHd{de7ɾ1V9kaM)Yp}WycڍU|`uNy/c ܽM<]{}U_aU>rУq;dghI$Mq+MJITvLʟp1\BeY1̗wQ1 DVs&EeJ%Fz/7 [mk1 "^'{޶<Wg|)/V 8r)uTo>w㖖 z8%i'~}<o nzW*j!0[7qpG!cH}ţ1F/FaC,Q|YR5%QAi=P^~{ӿ/CmjPM; bI ^[nmuw`UmoG(z?n6_q/+E$RYuWu+v.׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{_'r|BRcT5y*MJ!&cΥVVEDQřUIuݛl.d o3Tb~@zh쌖wf6tsJI\GqǿQ9O9ginoj'_;Ͻ̼Q3j>KU :)r''r΍/a[@7Y c'{}u~׽O {'|.Z@?y~}Ky_u?+[(rOp+d>]s]Ryȿie}{޴~7:{^Bo [ݱI6bxQo.|V>hQI[}fPWsZ✻$n{>Ƒu;k>͈ K}:zvܹNv5Th~uM1FM"WlsRZl*Wޙz^H>({{u׺{^{{ρ?۳i*mN'1S0:IU6kT`n}%>9\MS/b9~x^sG,CTA =ΓX%^b E<'f{A CoQI'aUb<z[juyԻhl&?om5o /NigyY٘#xwn`{V9,ƃ UQ@U@ǵrͶrfE QD$,Ėf%$jdueV]}ʾoA+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{݃7OƎ}Cm>x0-~˷+hQdVxnTc٭Õu}y[rĆ9%-L I# 2;?1sV_Qw{l&%C`Ff MA᝿Zo1 kEn$B]_^go#>FL7Q_۟/m׽ܗx?tvJ}m-JGvv#Vk3uhN9w/r'-o-g7Dۄub0,|4+_t?by}kHm=Ѥi'ˤ)={{WY׽ߺ^~{ޠ,/.Qn^3vR.<KR.E[oS(50d.ݬo쭏s:IktV1;鎻qଆHmȋ1h䗺tv=J4k'qug9J帎E;CROgo#>FL&eŠ.폨/0e~vb?iltl/~{]^ L"vm}{؟=Uxn]W2=S[:p7$j|"F ϰ>=~GS~g}m#=w- \o$ĒJ6` HPNXH 밲$r:F]’ 0$O ^NS_̋yͼ3M._u zi,F)\67<}پ?ugڶKpYYEcv焉4댛Onyn$my\/igo#>FLeݗ +ܻs>B]_^,7CEu7vVO}:+Gۅ޹ lbD%vv/'g[A[nS痸v#=W/ =ZjI,= DS7'$<lO/^]ؔ U$ï{ܗz^~{߽uz4_6>U|]_in=n^,řt 7.孀2u1 /[6拭!e.a!6DCF 6>SbmmǨ(id"9nEH+A>\G|-7(En:oG|-7o}˷?c!}_.{GJГ%?`^Rw'ŸJI=2Cn_En5Jn93m~'*. o$񞢍ُw6e}@?t{H?]{||!toA:ybUAOກfRI^܅ydִ/D{-rV+<>~r$x?=T2O{}5dz,r}nuJ,9<{ ~'6.n9Ym{2{'ƨ?6Y%}=;g6>dzწ'6ΓwgG9% !>k޹n9FڃvV-ȶPzu.7%l㻸d\ vW^co,v)^:qμe!UV}ĐȠՔ4ZgSoxS̰lpl{P.HT,$!%W7-ϻ|4`HCFA^x;ommݝ}퍷`1x6*1`K$hrOnn{Ow9yfIdsŝܖf>kn߳M6l8E4QQP={{{߽ueV]}ʾoA+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺G+O{>_b7ViFӠWЧ|^'^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽usq,)fJ,:z*:'*y0غ9d],сXA +I+5WF*G ^M?c;?urG1W[־\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/)Vkd*}}4U5rUQDURUϒ j$d7VGF `N^S## je AQ9m9pE*2+)r H ׽Ľ{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽twO?1X_]- Xٝc9Z*ekg Kq,"Fu>{l?7gW/b]Y_GKCACIO䞪U(Y(׺~׽ߺD^ߙ/?:s6X{ bo\,9]o.[k}ՌcUәaA54ȗGR}{TYtWg^{ﷷv0{j[lnl>3pŁReyj 5K=O==D.M H>{~k>-6#/r#q]5 lv y 5FV8tUb ߽to';șI6^>{9]ɈcudY`5&(\CM{^{u׺{^{9_Ks߽u2?ԟ3`:^>v= ̻{ 7w]NMW%X_ 6y4y׺~׽ߺ^~{߽u~׽ߺZS=R?_{'gzt]O;,mm>odi˱NqQB%[~-~/|>.U1{3ɾj<lP!o2iOu{^{{u׺{^{{u|fdU:ⅺ-zٛGv>ˍwW?Az~j;AbXX˞{}ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u*/0w~;ۧ`u,"+0b.C'PaV %{=DUK44GQMQ $3C,edXPAR.9~}~ _?$"z>\F=͹vn"uGkQUJYa`8{S׺9fk|8kb#k|ȵ#%Z5l͕@ꠐB@~V{^ _nG~7oYO-E 3=_^y*FU>*7{~|^_"?/ru wa>/tV O%ܻ%bJfPT}-XߺFY_-h3 ]aW'rfRup>{{u׺{^{{uR|Vãs{u"O˛*}/׺V{u׺{^{wsg&.}Y}Cl ص{ktn 1B|`[/{c x}fwo^lOQ>RE2[}{g?'QK׺u׺{^{{u׺{^{{u׺{^{{um#;_Ի۵zgptwiwN򖋯 N;(_ {Wqn|N,5#}{I i_0N؟-7sflprv"U&Fc h={4~&U,1'G7l}*2cg7.cpVi9,|TGbeU@ {u[JG#W$#ISY[[Y1y$j*jgMٿ$u\2k6OMS ?8oZINȖnq*@EuNJ||U񖶷W];{M<<v5t*憇7"9a{^vj*% ybbRK,U#4RYs׺_|7+~H5TT}&R,lZkOڟeIoP~ҋ *~P}[}ٱM썓QOO"Iٌ1awLpJ:{u 8~J2CweT~هp <Xӟ~*m͈ٻ`ϭߔ8 &I{suA LQJ܎זx|sH׺<{]* zw{_pm:ڬVmuPJWܿpddS .dz"xGuQS!ݒjMPQW>S.WpiK.ae "ѵV=X[s~lI_?!|Y=&׳ro~|l3SF9SE@J|;%YifIߺU A|D_}A߿{^s=sm䥆jzmf4y-C|0gu[I"߽u߽tfh˯n|?vn՗mvǭf^/I K4HƊK{^~b>tω؟-A?bf7]?DuVhhگiTvyr2%f }bf׺/} |~G|qꪢzut;[+gj$ػ*\hYVu5~et 0]I<t`؊i3;ksajo n6 zYF#[ߺUݿJ'[z{Nw۸*niSXJ|Y,F kڑ-{^{ s})w=O]YM;g~Ηi>f}\j5=*1ȚAtC?΍?WI|͛ojev|4{"7^f(%GtEJ}oS̀<7fEu5"] t6{c?:vٿ03f:·av|4{#& ׸ǶbA(;)NX{^Y/ 'ߺ[ug𥯌_>[j|~ݸۗ:=-󣨭w)ȖI~ _c3lϕ}ޟڛ!vSM,pX9IQ5T@J=ߺU-?7^SlQٿ%Xʩ7 1;*v&}[!c+Uh#-~ {|b~H|o*zs;[)gjd؛joSi)}~noC|]gcKw$8-σj*i ,&s3.L)i&RFu~$-˴h6#=V;fmLu<$)<-[r/o7&jius~j𸍟E*Oy]ʹ!o=B8jva1r;\܁s~ςO#~Qu6YմؼNo,gk.BUwo-w˧ɊBVCߺFgž(-ߔ۟`t'zv[WanZ?/-wOݘꅏ4/(̤~7 :OKIm S;/U}xh~3 >^voo>u]ձj:=Mc\eCcDPM7u{^̾U/<>Lػoqlw lƾf W3HXs{uo:=?[OzkNww[n,OYM"l6Apae3˸#h"Eҍkߺ[)/viu/Ntrv_r>˛dKck7&?m%8mmřUY?U=ߺW׺–zڊn{>.ӻ./~.c-~')4PH~P6{%\2 _>{|!K$X2c%qk-ߏ{^|J=ڿ'zg~#V"]+Ϫ/#gW  UUuN؛c:|N닇7cw6xv#7FF(䤈2߽uV/'Gu,]gשٜ emE33]<%=ߺG?C[k0:;YQyv(^ bjٔwPc(#M%CDQuD= ymr 6=DQ> PU,,Qk [_cvgTT^l<2 #~/*~0v6mOf +Yvv ~F@-^X%*e8l`ҝBߺ[a^ػKzv׻;3y\.knm(Ueuc {ߺK~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~O򦒃W2XM^^Ë\U!C; Ha͚{ߺWkjUW~an}E4bENݦI yz4˴XG>{V=??yk~9}7BY4K  uQƷQSHf?~_E|~f| aW޺n˧cvl@@ Q=ߺ[Hݾ> )(uGϰs EvtUWvgyb {^9@橛+~ٴDu[׮0 {K=ۆ5_5N{'ʯݐW >oMrOoՂȈ!Z]$U)k{ߺ_\^3!؊*W/]IciQR€5U2"K3=ߺ_t߅_!gэJqFwZut|Y,xnͳ%J↪WPP{^ 0_Sߗ>{|zcu~w8wzs|vw+s1cuL3²vCy#dT FHS)uEg_?o|>nI[]sb*6fuv%A8ׇr2*T2L[>{ߺ[|,yO.~5ߐ|~ٶT?۪=1ۉ߽|xEI{i>ձ©?.3^{/{^׺B¼[D'׺ǧG|C<ߺZ3>{wU=u؛f*6fuz%CxLUTYL5n?!C1vOKQo{^aFm_7{&_7WQ՟&zq&JLOvu6:bfVf ɴAd8Ҡҫy ׻?u痥?cy)C[gUC2RqtR!}ߺ_;O|쿒m:ni1]Ӹ6,r=YjGD@ UL#F~ /qׇ|a:b9Oqm]s[uQEFW[ -Wr *#c)CTGQ>հewgG퟈?%Ѳ0InwwN3Ly%l'z ^ lZjcZ ={2]Wn\mzS]]D3lbJ*(fZ8bLQF~oc{u^gήCsӔݩJnz]c3_$.{=CxnUK5UE~}n  >{/1/ZߺEgH|翺w{M{}޽>?`-Ѻv_lnZ\uL_:iVT< xCEMaT&(Tv/eI8Aj Ր5H Yg<>֓.>,vocn&ܑcjdd36ޮzR)X`JȚHk~o{w\|uy\7Oɷӥ)*dwZnJv&7_):{ߺ^~{߽u~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~ցc_W}B'.(&K}w[Y~ky ˇc4{{7O!xܦڴ -^G{^d[~x>.oyߎ[:ou\V:Rj`4o{^g?_C|j܁Xߝu1>_s@%@!{^iWgwObcvu?p,1\s%]4!HN  #qǽuT ?[dz}?wV<^ .CF+ٸ{^~Zȟw:S:?$>CJO%J͞g}tr.T{^I+1lfIb ږ*`qۃ+1LZGT6 q~}ߺ_-OYbt~L}tM.nлwz㩢eޚE*OwN#ՒSF#ag>{O{^{?{^ XFÃnu|[~8m˲je|oH|~.Ra~S%gߍ$;{߽u~k ÃQ{uD{ǿ{^ o_@,{^-?_9ۓM]ߍPDM?1uK G%dF[5}{{^ ژ=Tcqm/R" j133|M#?q㢪ߕ}*gb9'߽uBکWI`r&c\T{.[}ߺ_F/Qje{+|8JiXLWvvO6I2׺u?wv>>n|iꌮmiHjoDAo͑kݵNunOu`{?=|C/nARFb;{Stko}3Gv 0Qt%$L)qwT=DHFb}{vSwE-^D> wnO 8cynEt:yT׺{utuώz7vwծz: {R#%]f?lct E]<-tߺ_?~ۣH>k#ۚlݟ:=הw/ՠڛ1Pv-T$>{1/Zߺ[? on(2j϶Iћ+"F8F[뱠F NvC1+zZTW ߏ~ X%*HfB9b62H?=ߺ[#Ž8ۻ9}Z1w~)Wj% ̢n࢑߀ߺV~cK֝egVTE}_{oAX,7Yc!u38~}ߺ_-OYbt~.쁥gc$NotYA|f2iv/6 u~{߽u~}v+㟈p|~֔.UuGMCI<@9. E~- @uu~~j DRQO[_ &F/Vvmk9c:*l4mc:׺H{uM2?1{+p{uKau{sKt~ּ?~78;}ߺ_a~3Sv?P{u{ʿfP_EPfʨ?)6O{^׺ׇOn9s ~|}ߺ_~o޿:'tY?~Gh_>{{^@?\/g߽u&_ߍGf~{}ֹNI=6Z7^~eY<_Pw'\v*}BxXǿ{^׺[%ߔ;[_ۻo'KRtn.h|?huw>O -m4RjTvub@rI<{^yDퟕ'zl6genxM'[G)qcw&:h\n+0) ~mc{u~|eA_ ھ{?=©.<".dzi~^{,J8?3O~Hݡ#*{x; WXo[{^e?D/GdS>2KROwSD{oz4* _{^q׺P5!V:Z:L~:95SC%:-h'߽u~}Qf/Y|I6?q>/uNWp*#0b3m|"cw q,M{^?K:?~o%?}G{^w~˓{o^R߽tT{"*u~{{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~oy`lװf>,k;w.*~a`7&. ,j[$m ׺K<ϐuyNnM,^#W]-l/-YIR{^f))ZD^VvZz**xQ( {^ oy/h3:sHUd5*eȩ YoJ:"ܧ{^}ߺ_m󋣡"+h<~!I7Y !6.Y {񩫪tH#i'xh㤣G$@{u_'ݙ AXW7'뭋fau;%FAuK~|?f}a߽tRξDƯ~ӳ߽u~߽uێ~#Cg}ߺD_Eji8WG%fޟe7%^2+,eغ쬃\ O~|ٜbYJ3aq|6cUv3+QKf?%&x]%TVV ~mkz;:WBMۻe|}],TyAwC)y_׺?./ݝ d]8Lٸj.Ml*kr/7碉Z!ˬ ,K&׺O~㩿U#7߽u߽to\.S?~ҳ߽u.swΏ׺ׇ/o#v3wO{^5׺wwo~ZU^Gm>^ᒠa]OkNR(pԻ&4d5ٚX*~hgdW?-1~ n:stw#!E?`osY\XoRee &uR}{VSێ~\gߺ_"_~߽ux䷯ O߽twZ?1W_Ͽ{^9׺9tG~k |Ã߽unڝ׻7*콙:y fvWmŊD9>JhZ߇>{4^>]v_>d2OO~Ts7PQM%n>1Nx*뀓~_ʳ|R[s}ԛ)#)2Ng)᠋wa$ep͟´_CR!(R)/{^ɾw²G},^}ńMޙ܂AYi"ʼo㎶4gWu=y8 .{z.ػk0X j1Yv)*(j*u1Q?ɿ=ߺ[{uJàpvVKY_|[ :6Hh+{{}|>u53S%Qwu:t8w7gnTM}PaUv/X_M^eEh{𿔇)k6Yߋo;m7k7wX=KScڃzTdx#E5~Vr$c_nޗM~Fl]A-nݽ=mc(2#[]&<3_׺|RQ >L|wl+qԵTsoqb"576z$YKuX඲:$o^ΤF{OHZ:-ղwO}4>nJtL}ߺZ8_nI0nֹ[tg{J]m"mУ N۫zm<7x}[!E4XW5蝽U"$Y]a.8lNidx斂*{^qE$QDqƪ(TDEQ@`=ߺ_ob_uC,=ߺ[u\zWu{"ޛߟW߽uۿz3w^zXu`inR5]W#~|V7Oe{pg7Wϙ5YO5SC?=Z릥hTXe<X* {u𙾽Wu);{Qnluk7d涧V ]8%^mw,kN%> UO{^`~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺZU~\Fw7R-c쭹rf=X c34O3nZdĎs! ߺD""\_/?A {^tp{i퍓hv]: bq4Q4߽t~k/ο1?Mywnu޻WdϷ.y<6Rc`-NvJ_>P:(- {ߺU@E|DwY{^qNۣͧsL+au>jou0׺{QތQ!Ȏ}1zͽ0;?7_4hk#g_Au~{߽uSe>{?M~uí77c^߼(X}[R XւtIOAhRޢ}ߺG߽uK3GsVUe&ۜmm3ur4l[},5uKU.Q[;$}{ֿ%6_F|%J.Ԣuà"8?e.c95F:sYS׺ J?/;|,#%6fmMǺфݿn{/Wݻ14y\emJ>B Cuk덋}g޳s.nRF,Yݜtl< jrI{^iSa185IQc)C G(߽uILS[򯱾HwWJ탳 mVK[:{ߺAkuO[[^N]en8-Áb,l̉,N:ߺZP|Ltym靫;{W0KS!}[+<0|tdq:5l{Ew{7'U.Jm>{'Mɾví77\m^Ю5߳Y }[_5kO/IXb=ߺZ_?5>G_C׺ݷ߽u'D|~h+r+qu썙%ڻ+ol=EQEI[VvZSXRt8~ WO2}T}uPb(.?s&F]O DoQXJhb~{~ROHEsJ?˗]c-K}_Ok5׺"z|韘wv]mlJ }׻j#W# Pj#0&XI>{ߺD3S\t}A5MvյvzllTQ6cbV7tZ1%=jDE< }{dw"&[pO(~XlͿQ;L6Z~ѣ3RPfvib,_qLGI׺_ X_wa{ciuNk7Cf/om>JYhM/@ѩp!ʯVJ5w~~L*(دM׻OqPL ) ΢׺9LO@YL.R~_;)[daza:nPngWvN禟kCE_Yժߺ[N{uatSiGĎuU9L蘰MכnKeG|~jg׺!ϱʼ{k쌆 uyύ>U 7>urh8U(o׺=?:?ܿ,~IvV g?,U>7r͎9qKlfsPkQt~m]+ԟ:ktFuꎮTvJ-#PK[_W+UTdI%wvu~֥?2?$_>e|o{\_:4eNJ礀%u[@'έOq=oݻrw {r;qU0c۰ Fi`=ߺW׺7r:ۿ&;3GnuN۝?:z p7)}ӾwU>^j4ի3D \{^wtW~Hu^{s~`v~/EܛﭷFnoCZ*j޵S!#P_~g*/_׻0뿎zD,K3:ϯ4Rҿv/ߺ_-υ7Oߖ>,l﹋5}6XD9\'vb*~ӆ+QkAF}{v[v.]l[scl +IOGU<|v' (?Ԡ~+=ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽t@?mY=;ch[7ozVl׀Uac{uww-C,si*igX0߽uq d1xṋr斣}@*SػE8y]M KP_ug;fT?ˍE)X*wmMk#iZ/Gbr' c ĵue*'xE1՘||.ݣCSN5B6M~RU)^**dH`H{)]N쌾^H([٘g?b.Uб%ECGi{ߺ_Qo~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~|@q-SכOJwIo|=-ǟTnU^?nz(jrxJVVdh׺_]E7&e=E=R=P;XM.}{d𭟘5wt/AFqۛ7Nmö20=Snv {b6~?C4W}d'G_fQ7u/Ktj|M=%ڝ({jesYz!UnPQQWYQ$T4IQQ$P$~}g,ρ]%R ~kz`1øN1_Opz2 4Xl5Cņ$QM&#JeE_{^ʽߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽uH?Ο2㶯Bllɽi;\`&[pBLڃKQf3 P}{k07ZQo.۝vg~{zCoZlu͓Ĥ(ÖUOuG{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽twEuOɾ^[}o wU,3Fro%cONRUA~6fgn.+Sٜl+r4%xаgP}{k߽u~׽ߺ^~QO$.qؙGju =lnW9I0ԘM١@Spֿk埭 , ^ꄓ?MO#"mPǑ}{W:[%Vu@ʼ"ܻ{r9[Hؗ۟{^h?,\E\zj38=׾|w& 1GRAόRqS r3JߺVo׺{^{{u׺{^{{u׺{^{{u׺`;kllGu]˷~}ɺs8C5D4ˑei11KUQJȡuQߺ@w9*~7=ߺF& :"9iex pJA{^?{^{{u׺{^{{u׺^~׽ߺ^~{߽uG(/|O=]]ۻ%K%Y>GKm}χƶ*į M<Ļ.O{^g+ʿ?~4gO {vSewnˬu|i|iܦ#|W`MO+Y}{}ߺ]3*+30UPY 169>{_f־Y#qqgs1[vcvo5Yڏl}.ezRPO! 0FWm`={{ _m~16~4[-oXUsdqy*?Qa^yiKWR2{^OsC$sC4i,R$R"HBUu ~?~֌?kϿz'@N 7_ax򻥶NoZbonn25XE׺/OwQj>Mn~:2d7>߲ntɚ--BJ#Nui${u^vh濷p;wķĞl^;jm$ME u0@ {uFOhvfb#ӱ7)ݕѻ;ӡҲ LB H$/f ߺ_J/~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ_.OY{H:O~҃SoMP׺}u׺{^7;?7h|.=;$Q`n}۪+m rt{ )4RHu/ZW߿vFӬZtnjijsiy,lw*ɩJ~߽u~׽ߺ^~{߽u~׽ߺ^~|l[?[#}=Ka|#|ۇJWQSӬbͭs׺OKpv?p[r0?" 7⪚glS5N;#B!d:$@׺u׺{^{{u׺R+{ǫߺ_o~c.?֟}ߺC{^{{u׺{^{{u׺^~׽ߺ^~{߽u,;/cVxY]^Zz^T1"Q>ܬ ?SzAeu^ywXo{JwW^o vhG6j?2?>KA=ߺ_xݝC}ʹ^}fQ"$lbVA2: {~Kj}pVoNǶ+v^ !˾3^m׺:|^bito7]72Fg$jar=ߺM5fFz:6gx6GRV~WD|fb髿O.n܇k7_;r$4id RK!H'߽t&mݛ^\ 6|Nr"J*g>{gN g;ø+I){yfwdd Fo*} {u?AuGٽ9APw/Q ׺t~ğu>{{u׺{^{{u׺{^>u)߁?̣-#Sۙ>n\VwFwT YoPT`)5bx@׺>(!oWvO:>ڻ^cAcf;{}v3tQb2#)"up^{{u׺{^{{unJ^~߽u2 x_~׺{^{{u׺{^{{u^~׽ߺ^~{߽tTttsZȩ䓻3z -QA;ugvF '$ (fOufJ#ꨫi&zzJ%Uydt`XEǿ{^ ?h5mwN*Bw^G&61zҷ(^a:׺~fS|_}۽A$D{ f']eLTu+{wQCC7MvvؠXpQlɳijL~ߔ}1rn{^}OFJWyrFo7dhg0 MJ- k{^@?"?eO97-ww_QT1⭗/y|gPK.1؜&R$i{^mv{}ͱ6>\[ v*yYÒb1̵ _o~ݣ?I`~5|tcz:41#k&AԀQ8NH|%߻; tn6^۸M=#.ܙuj ^^*fX*e6{^o׺=Tr;_~|GYuZOg7=)*dldPgq=*}y%-/= M-Gu#>Bvwo]jspU;3Lr%-C],I&uj…Wm.C1hxw*mcztnITI(J1mTCVt>oϯ]{>g {[rϰ;Wbg'\nlVm #e׺ޏI'L-~#{;|>hvfo-[kcZnQ緎W1e31R站CHߺWK7@|9eyI'sczJڭoջymMAapu4 W IN]Rh_{^#c6#stҔ+]=xpLI4TN $~d~TAOwEwie+WUv4t_S8̲IEuGM~n>{^vC{OvgTP2ao+F|2⿆;juG_{^^6R>YՔWAw>>#OoUiػPؙRQE$E<~g__- v&l>|7xm\~sM׶~vۙT<.{X禨$~||{u׺oC [u՟>^-so|zvQw݁tEP!hwVhڮJbuߛ=.޽tTNjܛMR]eeUy 'fbK ~{V_?Ӵv>+v\atoj̖4qWdzs_|E+I5-=TxJɉJWԳC~}m:vzg\OWgO[w t37=Hji*1їEYa{={߽u~׽ߺZj©׹>4I v6>tvWm}æ'Tƽ\;,dRVTvP={7̯?V.V7}oDŋCSQ1:b] Wpx~m-S):/vE0|ǽ3XU[!6N*-ebN$Aj4hɧ45~~*yc IYaT5| {]aY: 놤g(^khehuw6*G{^?(Onog0;ѝݣvbu2쯸MݜX=3ojk3-NY'{^>l:QyfqmUu2b[6:omc.*fm*nҿ;6[*%SuZ|5;yu~-GRaڙuGkz&ryY!~я9 Y|/nwUz~6vXF{6 _]&cLM {9E#tV|%EULpov[ܘ8{l | TSꧪ"׺w7/"wnOje=sSX1ٙ1l|!KI FG{ߺCo>,Fx*kzrn]Og^uM PSCI L׺7l_ 7ܛ|a>)lMPf6co/͒>I壒JN*={T{"*u~{{u׺ԇ}n^;߽u4E?`W~}}ߺ^~{߽uo}Jl'Wu~oM[;=KTUci7TyJ:ad奨 ~|~N51GuW;y_5 3;;U)XUy;ì@*a~!s8~Lt^/f;۴1?E1y<_3^>{?/*/Sf/YfϏ'!}-=t[ML{?$ 9 $ QUՈo{^EGYGc+頬*::zjJᨦ{^EX_' >>P-u;}.纲=Negf*1Pj B{1}.gxa]g6{C'k͕ syr_s!&+52#,{ߺ_Q_~֏S;{hwș1z??bb񝛷q[WpmEatun:zHFV7O{^f?G*1=M|o~)&~-rA8Ms\КM&&iunJ^~߽u=E.=wvw&`;x]"&o2d\bŚ,L1DM~k;q>]ۙ%Atf'yewlF|vf|Tb]Wߺ[&R˿DZznoߑ .kgf:{εyj=mʚm] RCI -SBߺ_VlN[c3L[ e\uDU3#MeBx*i&I"׺p~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~ |ee;|<Q6zv$YAmQP8GǺ\'߽u"?l?5ݽmgZMFw~;85mcR/m"j_ 1Q\`vz.vyTGӕ 2G\kH߽t(?|k!]E8ތdGxwy8*kU|59S׺E~> ?mҋmђgC[^&0I(ЏUmozn~* 0EI&;or5 p1cQ׺[?ȏ*yjy?vM;Ev-A4>.OߺZq>3?~`+}xd>Fn?444Nj)%5of`h7Iu^{',?P:k{n~ y/_Q=ߺ[…>a>)]a;+~`ֹ:Yږ'UG; |VXE{ߺ_/~$ώ?˫T]ԛ3w;;^ܛO[f}K>\e3 4ݿƏuvW6-ٌC/o})?hi9޻yҋ/yvb/{^E0,-ESk<}d/OYAJZ*$ $412:0YH<~kn_߽u~u6?+z/-by*h+0[HafhwUv@o׺!?\o G?Gq }v3=DUȝǖڑ2+=ރ 0pXߺVuAO56n %\/Y#WHfsC:jVVX\׺x¹~ |z~k؛%66TͿKV#/UMMP͐+橙׺UW:m~;;Fظ3.h0 ߺ[6/u,{7{^ ;KEɾNuٛr7m]a競_9*1U{r6B *y_Az'Gu|mL:}MԛӦ= p5-⧑i멖JJ楚X_׺g-9G csMVMA]NHjea׺Q;S5{1YʹkNPpXjI0ӡ:ZxzT{u@~{߽u~SN7}uɿmݕ;/߹ ${) m-e=K7 ՃHE:7z.2(ҏiuۻnSO;oi~ I,Ē}ߺEO?>z|z#nm`3H;Ǭ&Foշ-p5*e5XZi%{9 wF4[7rOLJf`rU8Ƨ/TRB@uҿSs]>㭛'c5d)[3Tm6w<1uI|ڿߺZ|8ɼ~f?xw?z~\WK1cpnX9jqGnW;H}D{u /ӻo8t-&;rozͿvWe#Xr[ ٬t֎SAOKPG~i5 "\=ґ|ts1;ptyc^n$۵[߯wLE5. .7n穲?6J423u7]#<~':۰Ks;Ƕc=n,kuHE{^1]ѽFomedd]ٛTlWg0D,SƑUPu$9N,&3֛cw;e|f Cv~ 64x*=0VbL,ST>/?/E]w*q|v5r@tC93!ᚒU1O,/~|ggm~h|3> ټ}`tsWMN"O;zu"ޛߟW߽u~{߽u~֤?uWuߐ{H/IzO{^S׺{^C!Edachr#*glOA>{ y>x|wV۝j$v]q {B*},v݉u?->tm׻st;S1{qh^m$_k6ekiɲbYd׺C^U>Cu펮ޘvwi\3Xa-vp_-JZz YUW/Gί!YjfpO/uZM|(i/9mEXDBG 鷿{^ vk_V-ە7>6n]wpdfijjqq9M-%]ILe4eɻ={wq5?o#{^?+?o#{ < >HM.SzO}o KZY|^k&_|ex>ïs]7&;1;vg2ۗr2Ves;_Q2u!I<1,9c~}81CJ7_]GMRvzl5W[,^n70fqĕt0Ȑ+Tߺ[ZJn[C1[[A;#p}yץxwQ#iA_j'H_׺|mo?woo>M{`d6FmRb6'6+YH%4$Ou!-??~?rW0:W{u8{&+}OQziv_ɯ8*nع=ۚ4?\Aٚj fޛoÜEW}J*"cS~ZZw }]_zwb?gm]}Ct`0{r=S\^[-,ԕ&AAM,^Ƌ߽ux@O᫖)Gєvsfj>1M≮vb]߽up{{u׺{^{{^~׽ߺ^~{߽u~{_^bqRvoYUhUnޛ:|L{ y(b~]M4{|A36ew>Ijt&bI$Jj01vҎHɳTW^P@,$ ׺KJ߼K=yE&٘Mh_HfA{^rFm;r>#5p^ìR=O=@Kb}{-@^ C9"9:;`wN`s@%}v:MuP}{-= ?pqwMoᷗlGgRT18^Ī.?ro LB$t~X,#G\l Tl7ޅ^O%4[}GM^o%$MH ߽ueul0b-Biw {voiQJ(bRo׺{uXO{@{߽t/(%G~^-J%xiZT֑e{gof__cѧӦ߽uYZ۪õg~Zgpy5Fߡ~ck1q}SHɐ"drRUWRQ}{ߺ_07ٿ)%Or='Y\ϟ)T؍I*JjY2)NZQ4/ox7lb8_poN$sRjv.8Cr @~oԨO7MU먠쮨FC1n$Fy:_xc}ǜ|9t{ߺWSߗ{gbY2P׺{uGm\dU|A,q+d7nSM#9}ߺV׺A|8>P% =1DH=Ĉ6U{uOs?-v~m=׺{^{7N+#8ٽa>?Gn 7lV)rX-pfԧ'礦XuW뽃Pljo?6wTF+ܝCԧwn՗JN2>1~|w%dc_g8?#>(U79G/y vr7{usrܾ{in Um|Wn蒦)2J*Tii$R}{g'1BYn%H`;{Qu ~j }%?{u濝j̄ _o#_??/~؋_cb _~^IDcZ-]^1n\>{{^ Ӧ%_q`"sT *Sgk f-1S?"MW߽uu~{O,:Iߚ SInMm'S3u5|axuEO7?@;O+⯿{^׺{^{Hg?!}ߺ_3N_x~ާ߽u~^Y|,}™1Cw1-"UF힀U$a D׺T{uGjcv-El-;kRmjlu4;~mS JBiJ:ӄ}ߺJ?O\ߺ@>2[˰z6Hsym>*h(it'%We+6xR5*~}k}wvς:uVm窛ruN#)UC^FХI5UAu./f;z>~S%gߍ$;{߽u*.%M~m5C!M\ڟ ZA>)r_߽u~}> wik_MJT6DK1(J;ǢiߺF߽u?;iy4z_u快ɫW{ kg?qQu.!ے{׿z߽u~}>'mvh?DOPP#T ߽t#NҦG\x%clpCR(S; ֔TyYLN$jU#׺f|NL?GbJްDvnjP$QKZ%4VG~#ô}=ݛ};y s}2۷*ZŠk]׺A'+)5̾7f~v^<`Ҳ xw+1߽tv?٠T?; Yz6䞷xMCH,J7.å5KO{^~w߻^dnl۵}T9ݵ+K+jQFO߽tbv||cNJ;|oFdS-]*j#fyІΧKk{^} op5~?~ W~Kn{/,[Q?v?>^{',?P:k{n~ y/_Q=ߺ[kž~/>O'PmLdٍй S lwW'P ibp Xa׺u{՛~4g7o86-Gۛ+SM6zjX B%ZjX$^??˱s=w_,bz3NzeFzMwnUTmy '_^;R4 ߺ_\K!Օ9V%VL 䪬BOSUQ+;Iu_uWsv{~iۯtdDl쌵qMc'ضCuwvG3T5oQLmK׺jhܟ̗]ٮ9܂!ۋgCZ?wyUL&t:6_h~ٺwl؛Xz8~j }%?{ugoF!?_~߽֯u-[eY߽uY_?C~}=ݱә`g7Y|x[""TI*M{ghu. T=uM{/;_7:Mj-2H׺3<_Yf'9(^ߙz(6J{~es9 (qiG׺S{o#7ow&]k[ WJ|>MRVTF+0z"WD>ū_-I|(6VԘNe]ꭁl]khuḪgomry dgH5;u{SoMP׺}u׺{^RYx:|_~̿'zh+bQQ<A,K!X(Գ3 ~ܻ/rd~{ec_^߽t^w}ݣTEbLg[or'3Pդ&]_/~|:~Y|r>LwNƤ۳rrTS0Sr-msF'C*'E%X~ӋԺ>7 fʤ)s;r5[oES"˟vdtxlt4!i={}ߺE?? 6 Of|-ɼsßrR/gPn,E mQPO~ Q{W:{bU;u]}꭫;t}GU͈B<׺ 3Sv?P{uoj? ׺h6?oooBM؝"lcߝs?oXO& }{KR cq4׺'v|&}{SrAM$Qc{qd7،a#aRQl"4߽u!-??~?rW0:W{u8{ǯ]?u2/2^{?{^3 wMW{^ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~M]CAtort6@O:rlamLʺ+Yy9~~Wmޝw6 vn=ٙlf/r% P~ ~'0>/[,gqSzl^wNFZQizg(XG{^QC 541SAi0C (UU,=ߺXh5̍,%E }Tk55e\/OUKQ QH>{7ۺ. bNmFZ)dJL.fVe)U u]ڽg[_dSvg\mQ+N3qv Ƒ2H-{WTήnٔe`tZQ~ml}*]1~,n=ߺK~ˏ#7Fk>Ncpq2o^gKM,BDW߽t.-615YSKvFS$"’c(7߽u}~#/AGe([tgke+ԝYs i؍ق@~jayji$UGSM~| om;Ӯrfh7_VN"eJl.e6jjgUu!R u4_9(>R|2w_|7hwbUoY-wkⲹ @E*aA됀5{^0?7ݟ{y|q%;缫M#n\WKH';[5fg}r4UY䞆A-,Vi{ ';Cf6Rn~my 6NKՃs$o=E4Pn H{uj]2ZJH& 'o0A jK40UU_߽u/Gxgߺ_kMSE%e'$UG7*lmco~{{uSSIW5TPOSMQOOQO:4SA<2G43FYXe$o~ɓ{>I/NNnݝgtgrf=nGUSW_v/f[Fo3!d*ז?{^꓾<|&'?}Pa:ٺ Lgna,B("TI)iV~դ|\/wݝ;zM&Bw'hZu_zgn⌥K⎥5CH^?{^꽾|Pk6ruN|ɲ8_!Q׻W+bWeRi-Bߺ_QKmt#+E]mȌu.Fz:79 14k/1O㕱~ֵ𶝷# Kfim<7̚N~Y(k6J*vv6?C?"\7)s(L>b}]hij{wjySip=ԽvX2 vV@d1,T~ vv7]t<5uM4,}ߺC?kTu6?:uSjFß;8U R4~S'9θ ״uR,{Dz0I!:kwYSR"~ڃg]nq3;~uo~퇊)+wlڻgrcck1s8ɢM,׺7w0YSlKPج]vA`i7QfaH k׺KNݸy&)65fC IQQK(d­Ȼ'߽u~|@?N/a|[>}onŷzML=?vm}ՐZڭL)LU$OA~i1>8|m>N}gjZ:{}ORѽMW|-ۙݓ9 _6wbboq3wEjZGWԡ|o'ucTմuUUCE-U4MSO2 !xc`Jo~79? Zl SmLʍŴހ,Szw^zM.ڂYkp]ke\G!\05%3Y<0u񩮭d5Sd2UյRUr5U3ZIFwv%'~{S='A[{>~v7q|ʨZ^ϸm-m,TQi:`aPUtuz{zGJ%./vNi% $x(.3'M j* uKtMPc:Ϫq65TcsZ\߽t&{u׺{^{{u׺{^{{u׺{^{7qV{|zX3ҝkܯV_j;]g5Ajeի߽t`)))h)ihi訨iibH*"-׺׺{^{{u׺{^{{u׺{'娆/{V%zeo [>),Q-͕H{^7U&.\'T_wI&uۛ/3 mn6GX% ׺=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽tɸvt`k%vqbh3xSuZnJAB=ߺE_ )Š{j /8~?u4y ga'ަZac}W׺28\m)0w#pL^2+RPP-z흁+ kGKm4&Kɏ,87?cH{OvGuNK=Xc7 =JBd9\`pCT?O~qxwݣ"3gwiFo+Sl5{^h? hmwXw(yy69[ ?Ns;ODS̲SW5^OalMg]N=0[/em<*Qav8l6Mb$҈>{g{^{{u׺{^{{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺAV螐}7['#%hpCz̮"0q׺Wmm65 쭣6~13cYXbi)).cu{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{xtQuo\Ao w,i&c+d^~8m랽Xv;ƙWn L-.߽t~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^w_'3uznߴʜe`,=S+k&-ouݳvۻUY'Yŵs! (ҕϬo{msvmy~4wB4D`׽Oe3܆ܹ֛_IPd1;3M.5EYs)Rmc:}~iwڭkeF0D%2kʮFA}m/m{ܷ(EUx#5hGm2jJ)SuOxb$,HH_YH#R`#]nN {I}Eѽ:bgm#'05X7ZX8%e!{_nt~JDMw$,:IU]#[\\|uX:5V**zMҸ#z3v]MQ'RCXM$JpE}篼{폵ϻuW7m"G&DJ1^(ue~r%^Ioi\H—@#w&LvZ|;UܻWw 1 L{S^f2J4j477vG5{\<~ef3$-JϟY=S^qo!Õ"Tj8A=s{xvF5{3{RjJ-VSVSO5UC"Te(tzW2{윭c \3N+ Z=*# Es^n=`޷~c`U#`IJj:5S^R~|\۟Cckn|mMS3ȼY皝"ShR<ngk[䗓bXjMsO׶;w^n׹whJ\T(^){k_+_cGefh'B2CI_ MT<њZjXdFeiaR/'w=-_r  _R*$#  #!ϱwk{+kW 5\k 7`(RDR ,|;{|KGnSZ,P,5IG )=2Z_{qtϵ.Y׵'X9[n<ž]S,DTW#g{"?#FtO{Okcl?˹7./ß5%|aWS]~DoWK#g7kAwÛF/Aa S 1`6#Ɋ8d*qKzTK75&mRoۿB0S5̩ z$ g 3J-]t/0f;%W%QIVuco_ו紩v]WgCvٜt`FBl8*̍1;gq"FV{uo/,2im3*=<4|:Yhn_scc@!LR[WJunvVcܝn Z?.7):--dz\T\\}=-{)NvdC,fe9W>տ;6es"KA^{_Oޕ;vjlCfN*%2}ĿRX[<>{ϞI;[6{<)ک#wO{ijx.Pݿz[B} Z^n׺{^{{u׺{^{{u-uv;sl:o FڢVK_.o#G"$pe)bK_|liI\E"D`W KkK}۽9wl¨ŌCki^oH_r~~q[ ?@o~r]{NJtP{G鍙7NϬڛ?snZjJ.Jz) 48aJPWsKcoov[TK*XUPEݟaxsyml) 16p hJ4֎׽ߺ^~{߽u~׽ߺ^~{߽u~׽n^0>DP}[g䩢[쭥U1,YLVGqIEQ#P g?l.vefrik[HC"ᢧww=`$PsqKhtyJVJyd1׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮȎ?Sڻ^Zu]Y h_S.W%&2IZD>=~ck*֗mQ˩5~ĪV{k$S<7ӳRnrI?Qs ˆ{zf|etMO[ckڋ!AWQȄ]]H>!ܶ Iju#YH`GA]Xn2X^^A1DaFGF2 ":?GOBurpuݏ{JkX_?Wpw_WC$>{Kma(Q;1=tSõ^{{(Yw#K4;>d<B׽>J|,o؛K;r͛)3ͻKjPaj(g;!q01O/m>r^dݴQM,FWVp"B C0~{vZ[n3Colq@D *,A$3Pu T=K|}yYvnCiϓ+<;>B Fb ne۽gh9f}˙G$8 Y>:oח]ۜ7 ^y h(S.RD*={'{ubOW&o|W=oBK%\{T<~.uWsvY[_z7~̠צ%u}ci+5K"Ps.zEٷkwtH lQxutI4F}z~T>MnqvYvwK[uv ^G|S *ITSE$37y| c)bt2I2AGoq:Kܬ) zA:w>chAܯH #{/l6_qe /!f1x|>&!dJj,~>9j+j$X5gw`$/+qo6Id`ƈ ; f$$.,-i# 3P $uwo&PvH TCS{†9:nۻ~)S"~n }mX&*g2-wi,g~o0_w0l"!$Q)pm$׽?; S~}\y(.:-þR4*>K'rۜڭApʕNG8 dz|(s79.9S,+S nSQ5_VQQoL^v^鶪go޲R,2+IOYCY0<027+O.ŷ7*nlWI)j tp s.or2mr6ϦHe9R9e.l-mw1̐1pc$i"uO:)^f۹gvn.,<*^Y Ck„|7}鷻~*(yN.sU5 /Jz#ʺoc{^|]mI,N4:P`u0{i>s9#b獿-BÚHNI}{۟Əxo݂M]SRv3nMḱI >W`bqj̅=D2Ȱ^9]/Om-ƊfJ[BAhZ匝2tFKVESܿA2D\L%[p%Ge!h*ן vuo/ý'͇biWky7;=5,UK4J%Ny w-9F~_K%ԭݲ3/„#Ru=:rwr3þ<]geQS்p]D !%edfGR+XA} 0 A ׽O?;߿.7dI/T4Xmۺy})zzhޒ\.&iJF#{]^V[9q-"GoU`$e!q+ '[l|PPR;~NoovO,ۋȣ?jo-, {{GKk@g:k#^Z^ړl菷={gIv_ǎuWmm9$<#LRep(=p6(dGEG!s*w8rf{:XhCFaUec\1_5k[U$2RHU^7VSN у{L-{؟;wOf߉}QPa79I9i1%3AOpQy?ۖ}X9h;+];,#,1\T%L4w'0C3̶wvS#%W ,%"H/iΪٽ:&&VItBJV8Ako9o0y<t}0 "qJ B{~NglFڷAeܮOk_QO>X=wmߚ ޛrwTnͱzEG];kbwM=YxOMMXi] [Y~]i=b]lR`ݗP>Y,3J\}o?eymٮYpi$ qZLuf O쟆@Oc[&RdVn'S Y% S!\cK ~}}9[.vnICpRxI &5+D%|AO,9Q^n9J@5\RAz_q]Æ[Cܻp)8,%d$SQPP%EMDlT_>vݶlwM&YpƊ*y3fn{Nc-q HK#UUO{t儣kޛ:X%Ofna04e`U`@eݹwu7ݺ[MB*taA"RT}>+N]vf3rLNk+fZӊiQ:Fx+NLyJm;$/ Y% 9P0O 0}׹nT潫ؤ+1hB8I;`llN;=b;+Rwnݯl]%jvZ8c SZ-6Ǚ+nO"L.;$*AƒRs6nVo{d׌C5ԱH<M7@4`E@>]{8c!:|[7٭J2r ~Ai*kI@{'܃yo=9w=Wna+Kxs+j*hz0oܳ˛߹ DIX"e}-AQZg{ש?~noVۃO#DձabclroIO!xO U{KPScr<{Ϝ˱rPcS]GiYw׈x#>"xRQ{ٜ\.o):lm]PW.No$JAAIvO#tЫK#,h"l>{5w;.\N 4X+ȱEp\ȩYnn+g "YIEX"fv$P]PO^%wo/[.LkqzM>W6Ư4ۗxmݤQo̎砪cmmO(VIgߏfg݋M6wݠ-QCZP{=ݽyxy6c&k!nec˪jLVh͡ޛk6o OKbVNmqSQySI{g}y/qXHV6q@7jck>#seL9VufRNLej'o.xw6ڽv_Kr n8\G6 S%BӤfGd%OH7)'",_^C#Ƒ4HB$jDvS(zh>{8_0˳:,")wH 1Z{tYd:2:S+n-ZE+0e%j8zOG7zn^; 6=VT:ܻ)ڞjR5Fa%}GB6g;'W%6w׫;, FNjXʊy\u?t_#e՝B8UvBN |zbG^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮU+2~I|Zݹ/~׆P,|TER!6"皬\17OcwfF^Xb4iy1Ox=vٺj8KA\EQC_{._' 1 Ճ-#|HĢdR׹ܡ u9y?CQo:yODw>mVvMZ;䧉_!Q,׽E?~R޿2_}\trҚ8zAƏ>+?>]sWi/?m絿Ľ{_"ǭaNp?{fu3Cv )b)ֻSIͩ6OlwrNhKiy[D(^y#Or6 du_po~]{?rfB~UWwjjpz sj{#?,> Am]{ò(l(&fv*^7vb (csYkvcvwxk_ܭ wI∲kX5TW=ڽma_4C:N.I$ )A :Wn\_>;o-o.[in*o曱:?dc4NK!?[v\tY,~ާ'mmIEFF35I9hXeHCfeGĂ4f!O Q$21F?z vKmÙ٢͝VtJ Ap#3G* E =7/[?c{ SF{vV3GO̢`m貰4FMNd;r:Oܟzvv6;}SY\F&n d4<0q;9}hݶͻxdWp:qwP0p5)~%<:tsuYÙYb%6⎚]0uTgz:-Ӷ񠖪aMMWCNijN~ s y脶o;kx~17痿t o6t=kW sm* ~3${H==!{{دɿ4:w;1Uj?[пgW'[|ۗm=KKҮ<}oᔹ-DžIyD-=柼>n{5`?wKq2A(WJ) 顧Yg.{n[t~c-D FYu Zd?;EzC2;MuWa}k_ު]o{Y/?o#I. ?}Mn|]t17BŀU$RA|?tnI =;ZO`ᨹ% @$^M-w?h|n51,g.Kwa-RSEIO"ܬ9 *}?1m<^tA+^42Cӌm2#Ƅu}-ϙܭImm**YĢb1ƄpYd{ؽptec>8ta7rvNAI.zav tZ(H9D7yni][BeTZB$nLj#vevd1~?xnc됷3c'|Ͼ;G15̉oT>Dx*I% >R7}/w=u[F 1 ,$btv`5M%H{<c#zm9&9$I{rJZ2 WT^b}z{_stͰoVd#]*L~oK{e]h8 È9|;<|g{i[?YuGn]utS܇^NWuQŤeGmǶ*1]\{|qrt-GhX U0U:K31V%7/[{|v]r7[&O;%OIt,,u *Hѳ- ԧH=vs˚o`}AYqJtտuyZI讣J$oY k/lm"ڙd_XDf{Gn}[O }weKnViԴ)[d7߿}.|V~6O4Zr[;(ΈTt}ng7]_mlHIJOjJ)O^?;?)Qn՗r&- Q׉j7\@M:εţW{iVI LJ&,~o>{ysr_3\mw3iVo[Ҕ^I ;#|ؽ+vܝ%n,Rc j qºPzczܿ_urc]q1Bjj$;ze{߼O s12]W;&Y^~ր "*u{=?"Lu{5g߇O׽_oT;?O_( SD>*l677r@:̼9$M2G 51+țҭFxQ,J$ƨʺ7|s{q[E]_IEbI&8$ǥٕJ?S3^=v^6ܫM>ڻWC.v("aPCVj$X)"Lm>{qGnQI. Pٝcr"$RìJ= ѬPGg+;>m&A FG.Y5sVUǏoda|iwܴu+iHMY'UzSbɲ+acCrcd{UcQ,2p Hs{vvʻ\02A(ve] x阂HUƏ-daa7c vOV.SYd1UǡO;ߛl4T=&*qSaa Z3qMr>{n-3ՠ sB,G.d @kmewvKbka,"KBqsO\̖߸]D;<3Y[#'y*>GΏf6YomJPGF "Dͷ+1>'^?w~^R 5>GxsWi;}m=V%=xB/Jy[rwă=#뢟}q? z| ?{O#?_߷/Kou]?rWԾPU&a;~>ڟf?{QhPu_v?isu{- /%>ń_||<_}H~_9 ?ϯ{oj+{?4 P7ޙo?:/~=_K_+>pt:M:iӬRmgu G_[OjuW|=U)׽W7Ǭ?n.ClTS,JH ɵE1XjjiihUXTSUT_w{WKu],ѴT2,TS {i7~o2[k#EhWdֱ )!V$H=Ľ2})6d_o}ո^kC|}vnvuhB.]tmg~>mfӔ9_oc%35k^yՖ;#ډ]VO5bGOeOZm_ig~Sܭ}:ˮkK/#@k_u򏹜w(s-Ņ_Y4+RE)zϊrowg7fܛ9Y̮s-qy JQ}]l#iU]Mo{.װ{O/IoYĵQȈRM@=wڽq ui[idjjydGw4Uh,ez{xo=.[n++2qޓ%C g}9O"|^sGkA"4oMNùp')7suח, IKdJ@{]Ux{:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮ9;[ug7NޛS%QKjV Sa;'WBH+䥬G A>rüZM.Z4mRƒ!2\c?77뉢x;{: ӿ-M? *߸:vl$,|Pnz9iݬUa*q~"?t/Keݲ?mw#K V;9׉>$~wwwsVed' NbaD?)? _j/ma9OsMs={ޠG}9Jzݗb^cd/ĩן-pH;_S>)sKKO^ou^kONĽ3KOR?ISs-vu=m}z_?+V{)+h맢!aY5s vۧ$W6F)>q&V8=j Hwu]3^ w?_BjXۊwVϩgܔS7sܼ*9Ÿ^U}(gwەndX~oU|)C)^`),F~ [Gh*(z4^׽bOW&o|W=oBK%\{H‚?}O"yog_ݵN/]'OWFCCt`W^'z+:7:9ULYD;CT:݋RE3 Paoyo;3ګyx2hG :m&xq0-OqϽ Q5U{K-x,U6b# v91XcǼmwb'_ޛ.q׸%čuqIOD}Y=ݻX$oN"?Ă8݇ʇϯ{)o7jTT콳ژf+Ik+MO<1F=r(3'ޗ6O uCyOa&PqfF#w=OQWϖoޯo-l!f70Y311`.,^޸!{6vކF]UY:}ޕi7.6l~{[a>ܥ}mmb? f[U$VkZuO6i{ wqio?w V+׽OD-J)h%!XH,I POr܏o*|6A+u)# uC<o]I&?{_=b?j+iftb%Jn>ؖLܪq䅅m~m_ UiŸC}:=ŧq4Ec2 H,>ZuTvW \?l|J}cʙ#hWmXw&cs<%ED7&>0u4}H@o(歺vǓ-V!AD0G4_O+p>\=ee@I D*1RÈ={PW]vw-Wi{)Ow/Vv|Is歟۬ﺇ#JӮ3~H~Dw${$ܒwtI}7^E}5 eBF{ >vOV.?\5^N"7=s̴'o|̶VyU)u\C34Gi~jZ瓷8"ը?> -f>vm-oZԹGg]q_!ףg"]IAIOU[_o2tZ;ru$I$* -Ѷ=vcܶho-Df8 RH1i7lΪU%pP2M{'jhe8)yqPaYd` bl= $qFbPI$p$fGRI N{Џ]@u&}Tr~ 'IܔG5>s=9G4mNkna@i9z=.]ܐi[$x_˯{7ǝk~7Z $g1{Q며r$E5$Z\<\}=_7. ֖P KҀj5G$Py?_^rqss&&ϯ{3iQm7PNuL&a»F MxhϦ=GRgF?3i>Wʵ4>{E..0i=<^/O?ZGFzD4o[w??EyW-߇O׽~'ݕ \fN83.'vmSHԑVbr%&x{c.Fw_Q,mLxβ>eVH\A?Ky}Qo3<0ULt:?~u.TGl>W 񹧭ڸ}:qm8d"o6{卮u;=ͭ5+5ķ8xfJ7ep T|^Yؽ60=0AxUe8(H #Mu*}>G>#quoI5[iU41Yjr<ٶu[$BF%E yeF3N>ꜳ̞cZBop1p,|cIǕzVτm-=pZBIjّHib9U#S˭߻ nF~mnBۢLǂﹽZm>37;h_3ᖝڞ"<uc{N!o# f)Odj/ӛݿ`k>_IPIaɿ 6Xwj?q >{Sh:nśWq{Ky?e}~];{׽e/"܍G!oTZn=X׽ߺ^}Ə>+?>i+!v{[K׽{?_:kJ{GE>?iie[X[֟G8w\y:__Ni]W-?} lʕ)' nJ-Q55 %rǷ0nɏɈ _|Z?b7Ri%횟ճ׽ja{Q:{NA3vT` *ƞ60,OW]֊m1_#sV$נ5?cz|6?X4 ߽_ S++ɍlgV&*NB ?FI}q}P\БO޻Q(L>6hsFkwu?YXTO?#g6̿=Wq>>K_@·B`0{ycy|56?q4X{?u)&N%:UP=r9c`vw6$yդkGӤ &OCm>>r%ɼ[$ w)"ܥu0 LP{/=!rnEEƘcE&3?*y#u&ߛ~7.6?}Ymo-bS$2K:f鏶>{xMђREF),dej *+>m=dIۂYZ wAp*dgtG&I :'x=܏g}M 4NI Q@G }ASKj']A:*,ѡcRLi J59^Mqa"FW ac ظ.H5|C_ٞ=H^E uzNc{w,9ٛ1A]md:SK::f}xK7m}oZE")$v񫩥EUc_e0}Hpdyݕ|H#8|_w^ݔ[N+=RbaaiVi!wv߄A4{_yWcs]m.,bE5:j?NiԨeg}|NqVהwWR A!gicC#'{ aL W nׄ:̮V$TTlTQyje¿arϼsmY+Zcf4gڟp6M7[x|MN*'ԎYwV]-vn qT=G<ҌnVrl(Ѕ7rAQ\z{\0K,9z;gs9̡aӑ#'jĵPrA{߳ٯsJܹn;}D;:Mtqzwoo=m.k'ܖH]ud"U׽f/Իv}Fs)+51RMw6$~漓~'c˼MkaNQK 0P޳oܼySwhk d]%He8cj|Ma~MEYٲk 6y囩Ø6edFi!bQ߽Ox}/r}woiqImȦ;iҁ?(хa*YMoXع=̓V\Hca%F݉5W%N v(N'al}mnJݝ_x@ O+ikG>zbܵG?]mrvSb5Yϩie tm>줙A]FaO^_GuM+[+1Uguv̸ ۙ8^7AYs'G$Ƶ"NHQ//{jy x{}:K4CD-x6 wytJex [ݹ'人p"ۉO");S׽ߺ^wKwGw=;Q528̦㚾o:颫PQg/kݏۛnC{{KE_J5>rOۿ>OΜ յeG(JZq?΋L>` :>c!NMӑo+R̯"'={i-\mKKE,4 jgt[NFw7 86֎GUN\ t9î9i~>+6T1f(ueL崫'=LqOKEZ! $aٮ]ˑo97~sq5ʨgPBHfIc$k Rmr歕1\۱*1$P jTxvtefcᎺ($rݛ[_|=ߜva!n;}[xbp:so {?*{-*ʡxw"EI$b??.IA t}j"%4$n%) ZdjHeju@E)}h#v0Ʒ7+#Qg=h-9nXxSfJH*.AVP0{_e)X|n&/xZ AA+Ԙ3x%#w8`d37o!d.Sݴ8vRCE%`1+unsOv;:s7,ߋt&65U'QM "\|"Tʓ׽]/־c{ %һkuǾ$m}m<&)SNԘŬSMSU=U|UJXC%HӞ~rկ>s߹[ŲJspϥg G qFmAb roޟ;n`͊k]6/Ѹxʣ÷SRʫ$Z[wQ|)ۿwv+;o!)wce*1}-,qZSe+e<>>s.\>ۺN˧SDvQY ƵS<'ol[$PҲ۔:MBȍ”a׽۟w]vO{lͣ9r-2KQʈoQC2s_=oޗO:{3򷷷׻ Ԗ)8Khښє Y}ܽ^>yޭ!{ˉB2(x׽ޙVx*rXLio b/]Zj'I,.{}ayr$m{ gxƎV#asμ߸$.GFFH#N1~2tŝͲUջ766r_w6h L}>/xVKC쇻o܏Л -,Z4R;MBȄaBNCrٹl7GgG&F6UQ #{w|˶iZY2M R1VP8'Xgs?uݫE*WK5# p'Olu}C}tX*׺Zmtr6;[#{C%IiiݒC vOj 7^I[{z5͓9,x4*I{H R#̣]jcg CG).ta$`ƷRH6"EBAw'_c˭}}E[. ڽAVcvZ6+!=Om$}jyv'wdO򵸌5T,W֬:%]Dܽ{˖pw0m/hXo 0Wia'0Jѽs^[09?:kne?|サCݡ}Ú;SgV»! NWpxfaG-M^>gc uy;ޛmy/o߷Lm S\HXV x$q)D@O͟w/f-fY!7s=ԥ` H P/QGO7;ok=0g"jh]"xu41qǹ_'~s;]s%eԉҤB .ƺQ~N]pܝ"U`XUqG^R?P?/#yL-d6v6 r8'8瞑"wErx_iWޯk7G ݜt%'Tz "( @8wOq^o<715K4aK(${/||W0Kݻvh*0ݗ]y#Ncy)+~")e"ʷV֠{f.f/vCy;i2SՍ/i4o/jT-fJญtZ5{޿vV[˧_>7l5y0F2qG]E\#' 3;bI="v_wk;훕ϺWWa]7RR'(TXr޳Q6nlKnu[Ff ~bY$k׽3{Lcusm=WnmxS$UxX4U{9}oydu[ͻf;E^,jB1.y6NRKzhD3w"¹##-F7REm=[Qn'ΘÅ-5QlDᡚUl{rKr?f e/ 4z@W?VرsJsK(9GZթޔzwΜo5ܖ&.zt|:ҵ:ܻ弛먷'}{/3o3͛j?zY|R6 s7ܻfcn޿zKKW--(M3OYv|-+m~,uӭ )%/W{yŝh\?xbfcDl)iHcTAt(Q~l}YnB]ݦG`#{i-g'Y43M,KQ'Μr-].y [;I9P'!@JP׽'wߴ9ѷz;blkun;tSTr۟nQbTT#ah1w @Jj&H4Y0Y_/'.\Xm7\7q~2pNve攭dR(-Bt܉|} d쥎 $yX(5d0h2 hO{WhOh1;v7Qf{ʍ]ܕqѭdjlmRܪ 1EI PIB#*ɛඍDI5{ sYGV@{7?xv$/{ tew>R:Uu#RS1#I*c4b:ZuvgX!@M#˜ lSSZ6v$1#Ú7>v7SnO3TEHHֈB'={ʟʷn'Ǯ޳i7TEw^5ᡟpn/`'ᖚdYH_{_ɺR!b(h+Fn}>iOGjrV ~ +"+3 m?3~o~|c|܎ =W0V\ffh)i$jo[]gݣr܏r9o}wIVh!XVdehcDG+K@딯yf^~Tx)iZ')]#fMzQ* Tzw\{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽un,zwEɍ?UPNG  IHDR(fsRGB pHYsgRtEXtSoftwareMicrosoft Office5qIDATx^]|; [3^8{B00eB UE *ҖU(!J콷qo[eY[wNָtd[o{oh`0F f0@Q}]Js]/oْ;]B }}}IJ4A34Y(Lf#nw41h)s0 8sBņ"CLhߛ@-=^M,x |  ƓU= Þ2W#O>Å-06HrgԘcI>C#gq DQbd#lp@bp3F?Lo( Sic g1cn:RGlWvAzLsbg{R=# % #t?bX#vFQ: /5^c g$mv2;̉#`fɫsSTmæwfިe.ͤ3F|[8PR% "f$vC}}J 3;HzT!,ɅB\:nH,h4E;*0?!$h# !i$JpRl^:ZKN8lݠ&nȘ*A/F<ݮ8E]vغ`\6n [T@f1KIJx5 K݈X$DCU[jZJ[Zw( c؜1̞1 PnMn2 9 4Q nUI:Sy7M#)GXcsf?٪ļĴrJa4z&Gs"ٕ 5gâD{Pۘ0I܈с6b\&%%a0K xT@9 LCv1Sh澃QZ@.7`xqu »#=/7_-zF%/=da Zo5u{KyEo߄YPΙ?w}cd#w㦝pL:$j ,#0{ Q"d?3Go1禧}cyHZfh2_-LG@?QY-viD67woMY0n٩lA09$GJ(J !`0wh<~X!Of0Htaj P5Lm3֠O߿h=lLh4Ȳ]B^z\g1jV.vpK@F!AG$͡D-0VOWˆí=q_Ĺی7\\eG|7x Ot*Pؾ; ]i'+4Ii!U fv)^<^`[tN7| |6+S=,&P0 6#.t:XSx <b<,& "_L|Vd(;񛩊HFw| \Z1{8=Rabo!iI. +I@3; *#-lHw\vIߋ?o|:qH_R7OtLJ Tںǭ]byӖ= O)xH#:ܯ9{Q7(Ptwץm r #"@'RN4 0ͫrsjʸAQ4b URWL E6<:7_ rN"+?czCu0SLF U|?g뿽ϼ[5.Z(qf/k0RoK Y{LHwlUvEt27(ڊ7@4NBNPqEk7s1CF eܶh«z)=Dm!x`غOb+y!o~H-o2Č|HL)h+Ts%aCaF`@ ݠTŷM$&_P3lHJ噗ܡQdaТ8QcF[I;G3Nl\#"i'6Uct(M1\L.As~u >[][Wz9uyUd/|*:mfq*O3;#=bIZ}?z`8,^t]SXcA5 c1L6Yţ8om d1B!7`kG[_ZX*}lAhOp򽄙K;$]` RQv`G#QNj hĐo= F?{#K Rn@T,1):^0j.F T4!~^3k`vW {&Wv 56J'GjhsH ) @g`:^K:tJu~0K&x,@8{z}MNGA@%XN*#mHTD#q ~aR 99}EZV1 P ᧍AOwށ~&jL[j_U9oAGKOґUmph(=fv[cTwϋ>oWCj̰٩E_D!'4 mnz'{`]9ҨU5թ.Q;-&ݍήA?p5&\iy#fr2K  Mv~'Gĥ?~l=`fnF@q BåP)7p/t^8sJL4dF RAB 3n#2}UNˀćxvYSy8|怟g:Zj| ;_<" (TH{wxxU,c6`fwF@$(Q?YwYEet  OBb> Rܫ) E&G”KG q8Cp4PC|`fD@ ƌߦsIEQ^3,D%JSbɯ2~u ,^ #'!DE/fT']"VH0ocOڸr" >(64%$cc3@M0jC42'wћ,z$X哷-nP8K TH:DI(*$X dG!x]h:rХEV@E3;"p+d Ge27?@2I E!G{\>MT@x8#C;) VQ2iqBg5Ep尘٥a3gEQ1HIgӹlɊD?Jyb׌F`K#fGuЋ+{]ڰ%x?TSm(6h"Ecf'p z}s6"~NB9r*/S0Tn]}~KѧH j-Z$9q! bskĈ~qsE)WT! fvC`Տ< +nR͒ڏRb]JrX쉺^wcN:x֎֥Fu4 =7 iqD ! C̝_*ÇR;;>%ꫢD_ R^D)MvPu͆)*fv%g<(LPUpNYцyӲ+'З9.泵mGXrq# ef'=@O)\5Rvv\<1;䱹Ձ^YrHlC%tB6E2*KTR׹4Ei.1BgMsv6C@ ]ī 12)?bIkj fsggh^Gա+-_.T{m$7v<=RT#=i-0A#Y 9}tnᕅCHȝ ?ojшaQynpan#H;}zaOZpo}%F2R31dD"%E $>*2X`f'9F Tr& ޡݠ[NZ o瀎 rM.&]֮J#!A^>aFC|'-fLhHtKUHI6igY]a˔YKN(I3䒋 &eQ O1rN;v`R%V&Doh!JIW[\2vf[c<;hvZL ǭ i[O-t ƈXe1O=hѫRz~R>#V#]sN5lg1~n0u\v5j偖*9*?QLJ8/"YP{'T [LKI4`^_w2r=@c G3;+0Con~y9:C/ܵ/<=\7 *"w|ݦܩu'NtXB{ 2~Y؁Tmg[J: ䷗NSSL: 3(LF R89AKN͈|L+E3&\B2p)$m[KÊMj@wqbdȉu!Öז ]BKnah#HEO<јaWt}p fv_LF n^\ڳI'y#y~n1sNQI&AI{H@- l+'%]nփƸGu(P'0jB@N:q;d5nכ>_p5v(Ag2Lof315}.K#ƺDP $5"#+Mx ˫GyP5mL3LXE#yѷwWr`4ӀHB*ww`A >f 7ùدwn|i 4x}r]~G@v{~7,V%. 2&Vn0SR!F :y+:Cq˙|0bf| 3Wf7Eh{^7DRdDb;gTZ+`D#)h&pDah`OQ Ƈ] #4[7%o4K0,%- ӣ6u{lDӻI"'ٕ4Xј5农E p:㡩v՗}x|HMO^sc&xI$S۾=mE5H'@*ص*0P9N{$2=&SSN S H@RXPSiCa`pU?#OZT~Ô1Mv9㩢nLtTA9S2`*0!k~rd1S9?>oᢻ*3@]^mo2V^M$l M7_Z7'0!ʋ5M.8e( O"xUj*XSj`Z01" TeO#2PY T"1qܖ^e1J1|g-!ٚZmQ59ͩuAe.DةSJkyid)%)i$ XFkZq6^Ru]cC-~^3k`xT^Oz5&P7wv& v;d@` +K'a `<8tU/w!$ۃ13Tֽq% !,9a6>sYmlxS0)&TJ>%N\2F@=>\}}R Arb:'-8!m6l$0j4;lxou;YX2[]Fҥ?~Dznbʸʲ܎+?΋ׇRBy^x-bE$tv?g\Ns ƵʭjsO8ч9đ哨xhz]s =OO9rxUYëqT%W!a% *1%7GUgOԕ]v[.sҡv.]}$p'lTg7 vPm9:@rY/[ᶍ^{y`[y3?n_%6hT!X3ر-1A$Ȓ=oRv2|"sGQٙv=q3:c-|-KJP5۬Im9vΜ.f=N9hxWߛslQYc h*O@2$2=#y0{e{(fvJ-(稽o7l:i^/T(Xm7JELEوDZ0O~x9'S{>SD΃m/F@> `04C34[0L.F#G3; f##XW?٩0F#' nH5PB( .(́`0fvxF# qFPbԊfvj]LDGudzN8%b<F y.K#ah0CH#+K5 VHP\6ФR\s.i*.11 "@IiϬbZNhΝ:לv5/7Hm^.pQ5٩zy0qдv6 P$K1p S ̓ViOD bp AT,[0oxy#tpMp. G &,$e0<*NbԓGC )~uO`!4p-@pwu, S֤9[]Ej%:P#٩qU0MZv撓Q+X`PD3xiլ}DNNaC!1I%(|'4\#l0K6x< D㶂Q *A%XR4V~SjfvzF4nMͩ¿skANvd~'fu \#`fI|r SY9lT鐫6C,(&Vb_IIc0Käg&'^H93 rAQwr Ƥۂfৎ F c.cO,)%jF(F | I^):Ud"nR@!xq0Q.*DF 9@)O4SF͒J\ 6h4i`@?{1lG^*7HVm9]qmIX3D!M[EE:);W+-)|2r-Audq@)å8PeGu.]..9RKOY {.*,f܌f:f,kg; U}[ci6N%xl@2(6_C_D/Cx({ 3҂ϐ}dyŰ>`U30(,lAQ NQ$Θ9bݎ,Vt{˜)Ahb%w=#:0h*]9ӱ`fiN8!u:JPb)ϙ$e=,rΘCJ<-]>h܄>JJ =D-YXzww,_~ᛏ߬:H13B~JG ̼1sA#>Y[)n]WZXהN!b=@jPE^fA̫x} %t٨-S%P|]nHdC"(,Zs9B7P!9l.QU>>ovT1ԑf$2$0Ńn;$)`Xc%xEH~1gP8a\pd |TaJEnJ/&!>#!NΖ}]'are+H5*J#k F1S`TIdA pAE* "H1P#t4%-;؜: &H=(yBQ.d ԫ  , ǖx|a2~3 \`<%@$Pe L"hAmZjtrfjׅvy@_ j4<֟{9|k qdE~"ȪQ&[XY `u*#pk}zva%52|`.K H'Bp9I' y7alݒ1`̮9ɖ@^1^ ďv,pN:ϕ&U3;. &KD9rKW=gNrd#h&JVɞOB H4~I%Ku}-qY0eœJ, :{ }?oӾp,V&gJFd9|/;0 xl^R2킙yͧ'nàIR<ú)5-bfˆV \̪jmN(JpրJs C` |[檃L53o+.'o|[{ -_+*&CS ?׼&m2G^Q۹U(iuQL;s=Q!Ht I^09Y'@*' ֚t|{5:-4C91;1S&ͻs5k+)f1Y:+*63w"}ژz0KJNpzb[{06Rם;a-EX̡ 3E1~VrɅwue/-Ccsף7̻C+6Kwgc>+Ϣ#$: ?\.gТגڳA#Ȗ{βwvoe,˳yǾߊgfnOXim=!>:K[5f7a.⮇sBdvWoi+Y / Q >C)OpAb܋yl 5wJWdEU;>ot }(ƹcfU4%9LW7Mxt%7i*r| 8_MҁRw.V1vGs=pY&Y~]ؘ逘0 3wr"3j9d PvGxDsRtyQ=aFNƖV]UT$ !=?[ݷ_l3vpq}]wNDPt?'F *]V6fv\LU |rl#*fGX(cUx3B?4 ߵjw_q:{:2[;"GPI:*1fvJD8DT3QTVyo7 E0M>R3P KTrrۍNK(5M<:X;TGx"KԞP Yf73#3f-]jORzj.}<-'H+r Vuzs/bT s:Pr;B_EMě`e0ӋovۢS=aYgGO0I Rrڡɂv.C11oh1yj4Q4-XGy:j٥rabՈVw㍦>vjU srdQ=jRtr%@"SJ@3NIWrD]"P}f&b;9y4ϙ5T>o|oűv"]f^}6~]~47?S_} \'q`f8lqC==r{˥Ԍzac+ϽuyP>;_eUsd1i} aF{H #InhƋ]{j٥ yy|y ;[kLY tZ3!Zѹlj·AO/M5{;CLwx)m.+O[]tϙ儬F?s\D{ EkNp Ve\ PLoxy5ªIW+H[ܴщ.:FF }IJBIvKFBp'ܓ};2 Ј}RaㅧV ico|:)SRGٔǠn@4DQm7andiH :^z{`@t퉖:3;Aq%5 #(I{rI_k܁=Ȯ&Ti.[inRiN*RF&HSb\f p!IP91I_H!Tӆ u'xVQw.0Sy49 \g+w" H fvCqe!٨[݇8NR*zpW"В%Jw^6| v'0;|2C ͈~|qGP`3GIs̝Ha<֕ ;I0LH,Kï'6D> .̯Ho@K"VN,,L-"m'>hދjmnMF^2d!4E #<>0@"^.$B(S_毤,A>~q쓊|ʣɫ,<}ԗ3z}]vCCQ )u~I2a5:Q&%K;Œ^'z0=f;4֮݁'<Bn`7gS9՚8fvZ֤"P;lq gLBS5 1LJJp=yj+%+Fk7"'XL0ɉ~ vfvR4E Ϩi 1(2>& /h!Ɗ$$}aU`&bzH$n"G:y兏[]F)4ڊf/䣦xj h?6r OEt?1٩ Ŵɴth K*Q+-z{ۉRȈwԾUd2RrG_TBE-zh ~|@qq"]bŽ!0d8 /7Y:el>"+WDܴj/,ץ bIުQ G-[a6c>0Sߚ`0@ T;ڊhh|HVPWYU ǂ3y, Pa]4! U +$wSl@wC@t|zb1>[]㓷Yv|A.jZH+ ilJ` ~LLmH[9zAMޤ;x_>m9<#\ T%xںGZ aNk)`D`sse Oc_a$صPh0@M-v1ί,2Q8IV]t Nu[ 4T@YW2)KȳERp&9 )Ar6/rv~ )cn*EbzIe0a'ͭ.l/)<a.DfֵJfvR0 FśV"/h!|NQ,hg\F|^ZFxoY cCO;ə?4kv<'\xw$LJu'JsUu}.c >b%8mx0q!5Z.j R7PH2NjXhzw28--TVOo^xw)faՔ7hD-mFjN TIGu Bjbf0`')8j遴PPjp/$Ԛ,C'ygJQ3Z ŻDF$" fܬZTUҶ @:/Ej3BNSC t4Ê?(|: bՑtٌDV049٨gs +Q {CWK畎Ck3Lfvx~i  JF4;S$x,(xl?鈂ȩ"~/=IsDfԣ|@̤r`f7@AnE.=çtC':lNq2jCGj h3˝O mC'/#7,/.DyZL!Y9img(2K$ďfvc{$8 %3KW=T&gREFF9Gj2]_eDvcgFʐďfvc{7$!Ij ϼ>݇YūdX2' 0?=r.ӗNQe0@A#eHH+<(-{&!)af D .Ah,]Qlv.%d,Po;u9~v|"4 2$Ċu"UNQC3;yx!7 H!]M m 4&0 !u=}.. ^J!˚بRfv@E@`-F4s vq8PVQ="Ynn<`i9æ fwϕfʲP^_ڈ"LukHǒe pU@`@r ؗowg^Зhi-${2D.R_ح!ԘnO< fvixtB`x8QUyA`v4gHc %GcK GqMl-ŭ!Ma(1˨ē<;.>ۭlnnUDa gHȍoNﹲvf{z.X vkLGGd]< ) 2ɱҹ,t$c}ACr7ʖwzȭxS Cb^ 9n I߲QLNO .1AHvlq_]{xΤMXML[ZtQ8.c@ZF-SFT໮#ޭZu RIT֠dp'1!]LF!n=<Rr2>FL1uOnJh0B@( uї>2xg O)ޯL 9n EQj#fv!+c2LuV-(8׷ŕ3Ld>~{uQmF XG}W$D0~.@2N2*ŏHHh u[-z-P&EqjH _˄BOn')!oBnD_f6hd%H\8?P_  R|7]:fSoޜl632pƫ;D.Đ VG %ث _TVƍ&Gv 3n0ͳ#mPͪV56!zghDi@)H?kl"fn{{w27;-wer󟷬~i5`MĈ=uRi C{vk~]&5*bS/d%wO@H \޵|ɉgq}mTkR ]Xh,!\NҨq?g`Kb= sρpݳAkk.sdcK+λuiA?~QZ Aw5`3m[ |(b5RTyΙ3Mv1E'~9}^عCh#',gXUKW5$z[vNst@ 住7se7^<LJXn ҙG$@u"h A>ؙ¥zf:xQa~XBH}}p: 6xy)Ͻ|*0OMRY y1G}o!wM=nK]%oߣa.{@T/W!O@$72 RxR/v)%Jy?8{ z2ˀ,TI#IX/]=-w"Pe u]MTjRWJΤ %O+z}HD;6Xt:{A3$-pA3J_\7e=D8hy , uO 'Wغ0nvtFVd™B>KU0P/ff%w /T}]]ǣ8SFFIAV74<}` @D1T.3s+Ӵ逹c'!M([/CC na #(c" ?@K&egNǿXT(xD9v,c3]}GA |%Sզ5 .ŇP.gF?HX3:pEG0usO] A)&"(H@4KAgQ`:C/?EK.kx H#bk$EJg+$ڸPh XA,iҌ%)3{lZo{߸ +ͩ}坻p2eyIJqS n}N e^J#WD5Yik/92"J}1YU[:#@rUbRS j%G2yI3#ٵ"A d5Q#Zx=A1^,4ȧ4tY%G1^d̅h`řd]aɫ(M`i~;Zh8CsA[O|Y|\h蒈AakGz`v'm8`ҫm~Qq_ֽ}>N:q*o1EA6NPT;I5,1ʋac4鳐ٖlF6CfGQO4U-ћ]t$E윂*Pe"~W)(}JaH|1iE|H xԌG ]ƯDc46\|AS/vSz{9}\ *`o hT;O9EC#b,c1CsY5ǑAQ40 (9EÉF6P}B#C+@c$ˉ'XVzS]UNCHz[sБq/ggY5 J Զ"!lcM#Q I^ɴynDNdb\ }-ty']o Bl[= /U”/DH{lGUZgMV-`u !:`($:dw(Urap_C$pX;xiyU >y}} 'k2?-W1 G}ہu H{CeٚCG{˅t DKs]BTMʔ1 e=`JHG^Sz^y4ww(b><e\@ylqWn_ԕ7`;߱b#Fޚ M#r6$Ȼ _ 4ZQs~{?}ӵ[޿ʡxjB }]?IwjZRLK S:^GB H+]Iwق5`9kc0bDdvCU}H+(dd@Ax~Ol((VXH5puKB?`&Ϗ\̞׫OLF }%;W_^U$iM M{KΉۥ'5r"4LhK[v:vm}md13b^ۏym ⲧC0HFWTn `Ⱔ4? ip d?u!zC\Ⱥ祇ϝƆhl>j+gP*F ;,=nx@]O@Ꞁ;`$Xk DPS\Prk* >'pab)tN1SG_tf*+zda5z>j=7zo;om#HQ?6(\^.߯;E 2;C#8F+” ϜJrHtl.!^kE^W) qJ`w$2lDI>sq0):E`JvqD;R!hO>a:βw{>5k!4܃jOCnBlVJ0ȫzfvB..;p{7$)nٸH5>:--^%|˞YٚreX!y6T$lS7뫴n8HÕ(rVWGhK揨&/k,1cRuf ^lR`f0 ZM X8 % fHCTr5;L(/!Ks:Wb-D'0d.2bX^F@WrxeA.K FN%ܭt]X"T)r/I\3 `y|F! 2j vxtzCCsHbC{M?c[8o${؍RPf3  5_Q]QI :19!:;A~}OB w#%;@A'&a#fBDZ ANp:!X&3ƪR'H 䥛40FTSϋϼ啞5-*;!TɎecoYH_eVV0Sق`r0@Fp(NGjܖAuHh Nu[0ΦN?8C<y u%1,2O<_2n /Zʼ"S+oL|6I1߭ N#0) (#l^bw>}J0wx &Rmͦg!>%ԦXo^~xmv>uܙ(s5 B-&?-BQ&mP@k_ׂ:ӯdc|0]cwG Ur]q !DhyDĊܰySGپ{Ӯo#a^)]*?LYX;PnS^*Hu^L^ ],dN- z_u0 xlw\>|·[َ3J+]nPJB8 {,dk4{ڤ#΀&sb{?}WP|-Rc2di ;tNmZ'$h βϼ ׯQHqϦń)\|f] e<€1os/MYrI~߯.Ֆ:D=O, ì[NWj!C=By}N1s}tuI;O^~Uw|9zD ,pq ܂C,%o w˝L-tqZAcKlwDq?|u1@&w=aor4$CHQg@dKv[hrqbbB .f dbۈ5%K8 Meͽer2Bxn"\ptbfd@.>;кx^i ^5&jLFPɏhI+7nޜ*,і@bv wp@˧ OT|3R%R?6̑?, 9iwnޔ lh'z-?]Vpw}_z<$evH#Y9&{q2i<0˓`uIS}.Qٜkp`v#tUC[0B5Ee߿87//$BD>$͓FA+ ؝?:\Iؘ#[bF c]<vp@6 ׃i1 JLWD99kBIfPq>@۰}pk7K mvg:4e*}% }(@TFd!Q)np@$hCE'jn+KI٧k/PPlLg&HLU5EANs~FP9JDC )* QÌh1rUe{lٌ7PAwcAQ!+#?,XGja=?GMhosZP6X.ޟ^[߷]r0u1 ]%Xm0ARoca1AT֋_1kc1D(̈9.BDxR}#E}E!7_h,1C x4uEg׊1U >&*P٥7J5VS}ZǺ$1Axg؍灸Ͻ}3*§<)|~gD3OV 0q0z>pm;! ˂e(Vct AdvIyP%j6e~` Åe!#[sj<vgI$zgZLam;n+׿O9Ӵ'<&)kf#h{wC@4dJSY1Gi4, Jؙ4E{cyS!}9? l@*O, Ak|/bڌͥa!W[OMC7͟~vd*yK4x)HDO)Cap.e'.?hۢͻxf^S,Wl#4g>(@~v(S9bvc@̒]K4IaW F@lS._[a}T}=]ͧ\^y|m^?ae$ظa.AʅŦe74D$l@ШL1 CpAZ? 13;( Ihl+o!,Rsi霋ڽ\jY㋋hS+?P[ xg35n!ǣrk\7ϛv{s3FVXJ<`pm40H r:4@cۈ…})zz?6u=3.8f>?>,6IsnflP=B 8D}\lL\0)D3;$)@3!8a\):qr9  ͪ#}`jAvH(\r@oBk?pNy8@ cviscn.pQ{a!<>bpJ79ҭþVϟ@̓5@s6iGpC}de=W۝n7dzG l,fbZ@$YU%zMU=BT"m9k-+(eoST@0q^ݳ挚>2.@@|=@@VV !X`_4s}1~swJw<5u%FɨœI9a.萏|@jOpX !S9ɢq^s]hܶi" zgϟ( 99qJAdgQϼ6zCa]ԉ9\;'zKwhF}CQ]_/jF $NKKPB@LCT68QZHJQkaw P @i ѱlY-Ġ棛\\_㋳2VU  fdAPհlLF\RwEP ;֓MxܥIcKʏ胔告8?{e)8#ȏt@ M(5C @KoV ̌ʒ"a! C)mTAF 15ƍ;bv ) ׍ 4ycg,((Ĥ 4oX?7 T8]'=O3oF \c$!#%=)F S\i9$^_y1ZĊO꯭:㉔Mw>/1d٧^5Y2c Phd146P S^!(>(s;qPiNg bH8ڝXZ,}XX .=%FH٢OϥTg:VSatA87܃0L# $$ ./\[9Ot#6q9xwd^;'s,_0! DF  8HtXi h[TgƣYw#&ugj8 A@AfY1ٙ5C<5"&qݍ,y`M5ӄHEšҤȏѵXqVI6Q,y8l(@OK8A /08fN[//4$*,=lctRq0B Ar웪ȰqnӰ3 qu^K?EA/2jq c4 0P~ҼhGLQAq>Յ@4/a]R IŤtF($ы+ad% iMj+`Ϳk'agFiY< M6vqMl,E9g=%P#ߙ [詬z`և eGBTps\ѡ:Q6~A 2 pa﹐NA 6-7&:mK|b3px܏0FA>,,֔N!0Gz<CMB$K zu˗'PBOl8Gx}:aE*QLαA)ȃc+CnaN1YvԪ/1)F .fbGgMYI}sW?E  !35)# SuD(J s HRuٌDV0%VSb *}f3pl&$@|O5{/_t{B3HW3C^} z}|EmnL7%#\`,kNr~ 2눂pvbd/+@u^WHC@:( wmCҥ'5rk^M{Is68<1j UcGy+݅ܐJ>dȢi`DN8<1 t+%(0j0-"5Q`$ĘM!i8,g-&2Ν<(RF& L`{hpT#0d] [I6Up9IWG okM[BM&`;ŞI` 3h* Y9Ŋ1~$ܒ@2;B&k8͕E';j Q=7z{.mv+`"@@moPP|A@XXzz1n&R^(ճuUAڤ.](@͡*BY9diwSeTcVȄ MxVSG2(^mN[@{9]\ӂ߃`U~RҳP//' 5ጇefch[󾕡 {'vVA8䐎&O Ԥ3uI4YTe ڀqg#(CT-d^ ޗ閉' 4c=MAfEot$xv0dUsQ3~ E@C>΅t8I$/(@ :Tgqaii.p=4p'(% dab=' P<n,"EZ/t ImdtYEPL*MxAbщ`0 X8-87#9udJJ4ZQZʑ#%a(G~hW2u;=MGO \1St$wtC@xtz/._灾}EVZ ! JhL{lNј{H 1;uPVMtFtf;F4s33yi.M7<7A)oο MGzBU Vb|!ej"oz QA ፑ0IЊẁ䆒,F֬':-%$|1٭yw^Xx5q:tAߧÅӈj~K?f(ˉEhmNNKPm4-d2}$Q`?Iip~m~zfvBz#%0BfjLĮ~r`~mafjS1{ ~S~@"_UrJ(hb>cUe6DMx֏R߿|+q^$>wN= _ӗ$1(}!>l묎gDiN?B̶FX9ڱ?^{ݾ[-mZ~حMf5çPh(N{ ՗;P_v_]㛢&. GԞzrz6߶,G!Xs~s_<mj|%[tW]QN@LMQ{+7@nʿċ67~t5" =48SĘ](Dl8DNj69UT g?ohbl̽mgX6|Pox\ʤ-_{yDeq/mKyEXkS~\wnұd-+|tֲrDv mׄdqKC4$^unEaW'Bhvno773? A8&yx@~ Jò9Yd@Fu rSaD#qd"[k 5Dqs33wst~Py"oK[RhX:+afuTnWiOpl!#x_=pݴ^5}JaKR|ZQ Gv;w:~yܽV]pr:5h} Jُ{zo?PS,BBNK7tk#$`*jZLKΫo!:!YQL2P#} Ͻ~ ;ڽTvaE-=ְ9QĴ?maﯭ?.ɛ +2{LFJf$|7eX[2ǜ~.2auS8Ȧ;uz"nC/vN+7:O6Hzhe,6 #jՉc&gY0$(%A5԰l.ڂB]$8BH%޺dUO/w+b2/Z3o1;0oW?521ȡe\f΁%ĥ -N8 u*<"\0qDp?.CP)uɺk5eMLa>\8݇^޳ ~ϻu aQ<LQ<0 m*Dyٔu8;vd=fW/M7^R6 '݇/]XL:\>r!`.CO#1vR4ç*iGޗuů޲GT?y笙{Μ$$p#j&^inPNW=g~V3kX!D˻_u4Mc^A u/5jަW]:O:qe/Twv.1S}fwi0`ЮFgMU{Dvʤoh}m{_@PDʓ(r_'D9^Ɍf5(jU0z1]W]r[WUGbrˌ*ki-3nQL㐁Hy2pRfU0DE˶2ѬמڗMB(|oոyok=,ԐoyS+o}q [SSR&w& F&_\V95]8eD?`1[G盍o%I\Aɵy 'i@\)d%̤ntJ (3U="?IjH63?3P 2ͺotwGeXA߹< sJa#ԕBΌ;,, E9i8,yК{y%կ!6X3hױRHՑQex,A).Eacy-VjȾr5צn\th(r.L,Of*|XzxPM2ETM~]g]z z뱟[:$Ʌ~qwNFsu* 9&ś;I.+ ȶ"MS@2dhAasHڑʍaJREzE,'z3 @-.\t!ŏ7Ȑ!pz=8\|&)[g-;b6aѩvuGgvu'#:g`G.1@bq{L^Ҷ]a<1گd~zdbdv>hvRqIjG,fm`͚9V/I?0_g94bN5 ;vu{v1>j')mXj#uYیVˆG\k'D^Z O4]бG%SG2c]hk', aqwp8FOOe FW?9\aT?b2aA䌊1<=fhtZj+#}=PxHrl]Q!xU[_7M(de l*x`fwF "^_I7dU@Nbcݍ+= 2IjRPaBהg"@$ 1E+ C6t!KJ1ojҞFknډz/'Ri#xsMA+GIԩ\ܵZ_wCԮp!]=gȽdF#!/SpQ>{  P̠Ӻ$ؗTl/h$d 5 y[>|zCs m|ۚ= x2d̂,7H<0\ZT@ΰʙH$ s NԘ4!z'ׯU&tU7V!Sl&ڳTdT1;wg [=vt(FȨ9KC#w$ 1)q"P)~h>z227~=@Wo".q( jA_MaBsDF*RPۗ>mٳjSy1T 7F8ȱUz [Pi7Y-6*M c>EZ"K qxTXp[KX+CuF¾ɎND {!4䃳T嵓-loDNȠE0;=[v#g#Gt)Du8RVdvڭ%CWr>,rj3:)nڥҌ%쒋7- @8\w6y|%c([Ԙwr~[J>"3OE\G W!BU¦<&rnh\2v&raS"*:u#k>rYxI .; SHyH ]>qaԕ Pp,0 +W@6 1Q@qϱ;lw/7`<ș Ϛy4!=l;v.,;+ V ^c)j|\9d"ђ(n4n0gH9gm(H{}EQ> z@[_6);,7SHdv'a+Raqw$-UF1ֆRa"k̷u7\znyH~v$WP IȹWKɿiQ^-A?;~[$m.3;/&U^>aa{ZC__>SM" ,8 r_2$&-<49!Hԑd1HiB(#Ȋ\B~v\ZνZ"Mybg]JQKKo ->/n;2'e =CJB0;k&p˸Wh.1u6 F CKس/!8jvqyy7D#laq,;Fc9j4PH.RԒ*J)X":}02EuGF#:,'X@| 5&P RzvpoǺȯwǰܖnL_S~v?ӕbhItHB!Ow+^{r*Hpam?}ЭF }7tZRQ-) ׏qYn_b੸ T5#jƠ (A8k'#7=iB|䆓O;O>c=YM+5b]_7@@rRb"JNJ ﲣ;9n rՒr rK@A?| &T |0ϒbf$rweiDg& rgx )f!tk=~á)Bϝ/sZ|qG4|@71w9jI [W/٩wm0e*@@GjH.9upXXy>مe9]r RBaskqPò (x #Ļ|xxՃ@bJ$tgu0%FUOMǁ {\ThHX58#cRJ{s(ݻ_w^bx\"w Ztт#2'٥ cOC}IJ.K2A;,BHН6d䂊 攎˦(5c@ΝU<9ƵeÜy; o)6G9֩q cvVbIt4#EJb',xsxanMغY5VตsGxHR51,ELjhs #G ,Z"*C4,*qlth:$]:, O#:҉L$nZm@!NTc$v LZ #P1yYxRAN2]1Wl1,sL"rW$HTΧB7x&AW#R析^G3;1=Ƨf£Ļ(}nt%\BwH`3I| lsHwNN$?lxr0R9-S9Jtjɷ{eiˡxC%ec1MH ax jX}N-Kb,DOR-jtqh|gigk);pu+l$Ph 2T* Zx l`}ZVS<ƠxaTGq'H'K=m!#yH>yHEuC` Ӻ3*i#0"O͌)%d7F@9'OhbP EH" fz1AFh XRp)QQÕsD{^mذdq#FzKGV-Nړ7PV*SQ+~ߪN]Ђ"4t q4}=JloT [WpLf9:C :xyDGqi;ӧVsf7? ReИ pN1!A%~S#p_TCm@uR "cљM2c&%`bZa9- ҟGqWC9@6PR$*^ D/j)ǘ/ǽBVN)/*2WM y[V(‹}GS7-=eqEdЫ;z?4wuarO<i+QݥLқG啋DTJcD`NaEVQrܕ Pa^INĺ`)H+p ͆/հYQ_oXBOecCia cesz#2gAǁdR )۾Y%U%ٹv++'T`9E%m 245&# k:eBI^SxS,HLzNR:O/}->lC ]6jFKtrCE/qN.,fj@!}-,\He0F'N L3LZM炃P{%"P{rjO AA$23Oy}: rD%l@//_PQaKjZH5:A|>Ӿt4%-;؜8V_܉<{ nr#gxy=gEsMAQ[t .kca@[C[DxqՁfvvoձ~CEcff`];䪋fyYOwA̎,cƩ᜗E A9)R&b+-[pRU7nxoT#z9sK61{Ri-RUHb5.&0X_Ft ][?6BV V[Ou|xR<봗wwggޫ'ft\.!T3"ĵ HFO>rBD)=7z{7]NE'ѝ/~P=Bɝ;m|l&@y>ba:βF#U!!)i.GN h9FNca}6L3ˡqecsq=2"cj&f'>;d]H`Hu!$ GwhޗìU]28I )[ )e&]ZQS9O,He{ac;Mn뺽Ue3KSS'vQqK7GK@i_Snٽ L'!vX8-87#Q%2-/fv{|g:ur?{/2u%#54+G(թ K-ΘV\yu7_\}Rc|<[F`ֶi0}١ o;/ *pOn[ёt)e"+H9u["ZWՕjf|Mvi$C93Ο^X1yT^0(͉.fU|AqQ7xSnհ_9,ؓW)8F4Gl ͘4rvd!bRJ]=T!o0Y,Y ||H >oB %;(ˍ<3(EMI{[0]:^a'Iu@ЫwNiRR<2#ܕޕ j(gAt("cvjfQ^+1$U{얽S]O6w-Bߡ%> , \B EPyv{!n9G*L0k 0sEBXRyʱDmz-n1"yz;bwe/',4ٍ(C"-^G%UWAq1#8f3I"YgYk9!|d(BެүWGu Ͼw>f@qp񠩘؁~=g3ȈECVvawp9j骆lfY}ጢ(~hbyAB;9Nr+/>~nv{붃^\-&> [)P %哲4,<)~ >'&>&D]V𗩼驝 aAncBFvnwUY|k%m=]5rsIZͱ S}/?8oΙwZb 8@]9NFˊ\vEMr kNzdi KL.`NȼlJ/RHM 6X{6)^];A@NFPz%&- .߽q5_orzhh` F3 pgLNC}XHg$Q*k䖹j-%4}MRErX.hHk/UŒ%R"g^.gJu2DvҝB@fq7aN?l.$Y9 w7:ZX;-'/esM`´7RM?˛kB?g̨\'L=tP_ugwy4?NW!RsWET"xgux<&-V_)7),kDmQ:#(]4C39vO尣Dhf~P:?bk}PJHpgך\O Ȳ;fՒ$`Ȁka3\`.b͵aaOX`pؕ椖Ipooؘ?"ݿۗZ&,(>~rbnhw #JzZ1$oe<_l%oQpzD*qo=۟=[ 2+ZJTT{}䀕Uu}6GK'-jEPynjSj .L&K0"FE)ťsBk=zO8MIsۿ+!LC@m50#; Zp4~u&!ۓy{k^)TP>UL j;5 yK{O]xyܿ#+GGt]KlvԔghtI;7+[izɼϼWO4s0 c=NJv(t~mHp0=78y`*DzI. yG f}\|jqeo&VW:EkrV֧V z4853hiVniG9~5)u$p"&-C (QɍLp7Nnh)go M>)\5SMXO~s%|k#83jf 55a{Q-_k[y6$AO"łn&xӜ=ʪf˯~*vp{6ϝZRq{[³0ϼ׸K*=h6+XYca>z5 2B7hF1UGF /꺋SX`qϚYZkw?aU9 t:eY=.+&l_[xLmqZzn :B= Y3oYARcpW0߱0.'NE֘\͢SŚAѝ]wJBs}݄-p7>mzY*odTTӇU|ƫ"5_s(5k8utBbf}#:~q#:L״[뀡+I3e-x3#|yFHB](8Dip@ߋ9 )'/;G5s\añ?ṷֿ߃ܡ)ngOLn<Ĵ@.hܝu3&~5`.|\V5tfG_'alQY!(gw͵l]su;FVQ}ٹc?[scv3ޮg960|XN^OzO&N@uyg_XhA: y.F3߯Y=w0`蕕7~ g tJ~x5X59nSA3ٓ k$yPHNgHݻpoߥgr.Y4$kUȶIؾG{՘,skfA6֫O5;?~plu`9L'M\ dȸX[5_A].^|e:1&w93R⫍'4>h`a ZX;7:p՗;b̧F71&=khmU;xhs?g_9wnZVR@^y~ȎdquS9dnuAnn2l[zBKP\r[_gl)xڞ{oa'D}̐x/kB B±5` 0$;@y~vƗ):`CZ8^>uCIBa&ĊSd4! N` u*R3 Zl|snҺG6AIFC^Ln˱s挆ph4dL5\Cp!bt{Nc|bJ/%J+jKGДN Rc&0Sׁ?|]|ov|]MY`>ytn~U`v~⤽dLgY\rep?ppזkʚ:è>\%wCDPԺ0킈WS;\]KΚ~fO%bƒGC?GdcH6LI-]D~uw_Y7HLM^$? @ R=8uk}V?"|Q`sx\mFKꈌWP%W>[?TxY,Ig,C!tЩuanS[kk8[嶋~PZoO!Ph ekûG B OǗkO~{ޒQS7!V]1ԝW?(eU{qǬѝSw1R p_0i _' +;KV@l zLS)¦"|XL-FoPGep17gv;vo05Ź2Bui24杽+ڏ"e#峋5 <5mg0TkMzk7[@WXFCw#/ j$܎}v1 - --!pF! _ AG!% ?32Ꮑ{ECZ,^.'341ei:J ŹS 9h?4"׃6XùO3Xr*鵸ؘB&x#084+YŴ. r ʉ0F$Ak=->O\ LQ>.qO`f滃Ќu|mΕOϨMi|3n,z7]m9mogL_ !) s9I(@`_.,H+ W^R"kͧ,qN)$SOoۆԘGZ! pVer5a.웝Ύ3Pbun\;ybҨ$:|VcR@HLLQ` yy<^fymƆfvᦚVK;+k'OW4TU5'p;뫴vj,DAc܉ M򙩞qy$RIT3[XHTGJu]N: ΟR*e c85NOVfiP_^6j,zK~#ϫTEz?:2DIUO@EWFt2qet0Q`т4VƁfC *S/Eb>xt`M*ilG;gѪ@Q޶v8EȡnuQ5/dM{fogj fw,@/"#?8\e32[뙆UlayKIʕVc!dR'Ă6Dz_^Wרol+.$'E/r(.:7 ѣۄ3(]TϨӁ"ՌFUg9j?s]quiP>{-bv)qHƃSᅣ^8OAk'fH4*fh"~wn3؏\T O:6 dt}s-Ey Px51Re4Ű1`3 R# w&Dz|wn,Gv`ub'!D۷*Nيc45- &ڊx/3CGG#t0鰴t?o XI檩k,b-;e%᱌H1HhpiBBwbPecy'f疻jtkFMb쥎xꦧ#'#yJ*nDTČ' f&~/tgj4g {^ iWwEr%c@).߉F:֩@c\`1HKPC uyI<4_av9ӧ}PHfFuS{c {sVI|H.&c}= {6xۭA'w%r*ܔ>%k*L2}# `kҩӕ_gvsW\qNvݺv}ή~[!i,:!6 14 TFݹЮplK oޔ0j(_΅fVÓ$|]ZCj$x(}Sԕ0n$W^t|3[<*S.Ø7Z# UQR).YR@Μ^Tv[0EwRbjASq'~9GdSBTuM\_k oGl]/3rN~ZQ<,qb͓DaJibXޭ觹, JʌʆT83C6ᴗ YoLqbs :bJ]nE3k;Y<Ix_dܽD# MGVcISCBdz1xYQY:Ո+0u ፜ ! i4Tp+N;Sw9ne'>w%r׼0%'‹ g7^<|]M6;$tUv7IqhWog,߱fGw'Vy /XkiGNn3 84^?o#+Uv{0< "2ǟ`8BH ѵ>j-:Nqb1S2gb+6u7!%хSFRVXDF:4m(2Zc+\VZc#<>cwuPZ9w!ǼN2 72,(*;r3(tC14X 0w1TNSx1f1ڹ4SVa5D_XekZDMIV`vq37o)G[i&eEz. Ϙ НQWD0;)AXWsfS}'#ʲ7mЩjX}N- j`AE$Kj'Atd ڴCIX >KHK<3po / NWhz3 #i4E>L3 cs&bP{.)rBds栳mouXrr.O&5|p O 6!bwP 9ѷz-CM a}ZrfԔigv !kXx&_d[w70~?'cTfTorX6k\~͚=熍?kLfKk"9G{" ƴ=nP)4Zu5 n]<4(9Vb@ \0!DHg0eK6Q,Y L.v}ڗXsHõ Q#d k#mQ*|k_l bRc^ kW[X[9퐏)d <5˾{a[}S 5v9 ۉ*isyiRMy;Wo[`V1w4/ITFSqQAs5iŽVq&5hD5cklwd}V~yj^+^ȉϖ=6^m݄>R8iwp?Fsk?J]UW2vsyh]i$PXF8w3U{}y+2ra)55u +Glo"lIxl3u9n0a0gϫZ wl4 ?X,5x\}Oj G`4~Wz*#^i8HJQ_cnԶKI}0y?{ĕWͶ\qo4` B\ʥ_r\%Jz%$) \4cl&r?*+$KD{Gd[̛޼4CWguZTlReI޼;co5.칎eSݖuԍ7;>u]*LXJ G0vBΰl-Q(fOIB.qP5cWOSvRt|нOiZo4-?++.p-:拓 뉜7V.xRfv~}%o\ mEqz$ ۧC1_2ddʨ]⾍>P4Ї| ʥᵉ!9o@U(4?,+3gT|@Gtrpˠoȼ2% $‘̠QRiĮ`dunvr^64lV8p6xyv/8;y?7Wܻ umNM-5sD;u*)lOn+ vcŷ\ʒ]I\ aA{].xmTj-jt8B$1!2jP9 "Vc&."6z >Df(>iAdAg+뭯\B_e/+KH&.Rd'E;ӲpwWtSqZeחiCv?Dz{c̓ rn; ?5{8]ǴZlkT˽]ޙc2n{NfvX9 Q]A_ B)Q-ݑxv?b]twFt4K̎ yxӈekRЫGs)v$Obu.!Tw~SKĕp{xfcnn(y=VJtfi.ZA58M)rb2mLx5* Z畜{ n2bPL-yc?o:q˥p`E8[Q+]:л2HIwK֕ˤF,w$cx$55[wpj, gV505J~3YGWp FAa\+ '@?ovBh,kP[ GN]vMؘN}@Y5pv`d$_S5GoV7e~f=|_"05 #^ʓa쑞L[\cd6L~ c'|",aĸC7 A%H\W (4["ph =se v)kMθ~䢗pYB XJJHR' Poi05>bY60e]rဌ5MͰnݪoPIm";#=2  mp !eThFYEތ( !a f޹Nsa"-̥в=8zvFy+bc6(Tp}7(&c G|4ʥXO6cdYK&uM[vrOј^` $\rvLBg~P+hM\[0xv{,Coη N(geeѬk˖TE\AH[][ 60y&iY!ؘaF+Y@f S;x]@#dY޹Tvv $s~pDFQVݩWyk_*oyV cLJ|}8'cр%c\XʽFL=Y-c`9*]?T`c/\46YYF1XF9>1[ѮW-#$8aLр k]{\rᘾH"1c]<<7dKP@Ђ̾F{=8(F4v[*"%֐˂tBAǸQH圀=.ehXfT_-7!71)rlL.OQR=`0ƒŸ1M]wVY;Kꮿ`,>sI9ˀ_dLJ&yJ0 2/8^eˌLlLxGV/(vv|v&ѳn~·lyv0IgUjn?#x LgLxE0 Ϫ=11ӹס?vp ;2΁|$b1HND;|ON<cyg$]V[QU._w^6t"̅Z0vBv&xs+}HztbM_ym[X2qm=o|!V+3`:eZ| ԁ2׍i4n=nLtk]N摛&ﮜS֩Uk"{Hgo z͈A$}m_yK'rr\9+m=s윔aaw7?<8I Ǝȓ]8bz3KR9=i:a>bܟndž-!M'|$mϏMVtp tv[ sA*L>f<.VK7瞙9pGq}I3ȪZ8$bh44y .H/$z|Em79' ZA#`r:|r:9vλ[= Z3S c`8yjܓgd>TO6a ^c5fPZЅt ȼoF0a,&$"Vhr21QwT" g8M}w*|YY= y畇u: )?wZ99%cr9_}WߢW-@@FV YTb*{VvN㵪ַ=e5uP??T^n>ۋqS`vףC<\P눪sFCxML}->lF 炲gMKrE1le% H]s0;`0 VQOl@'?s Y$_}NF^RVlZet1Z R}\ȑ' Mrۗ,-JFRpz9"27XJ*ZZDv00%:su7[Ebcu_21ǩ)R76T3l=/fAX@7T2 I(-~&OrnWC WW߬kazRdLzrdLC^nG_"rޏ|[w6vM, ŲY\9;+ˇ?Zjٲ~uщFz<v}}@Hg-|jkiY'pge9ur~ЀY2Q8|^Y|JKeS>XOi`Vٺv4fu  |޳M2f KDߞ:]dzj=lh(G8$&I@Kܷ`0%}!u5m35GGTCC%ʙ/EKLMdn)U79^5٨d-VO,Vvv;_&'5!)}tnL\ kv43+T0s.9v\WY<"Rb %C]k6tB0+IEq;oN B9)n>޺r 4fvЂJYP7@]jINK{[o2Sv'EK ĎO_RYsLGijne֮7[VWJ8NW=C?Ǝ薣(W$Švnd]}vW\ߗ3'p5\^x0gv姺:葰BC"XfD[ {@ڪ^4WB#?VF;fL P"Ƹqyv4A^E EK?KFvv_.DY2.'>cLB/;Y_OVsEn{BQwW3'  կ3A^%Z33+RcqUjTEQ5W en.=[Mf3tf@ aHʥ5ed9IA(m71uj.48[\a1EM?=ws4H 8H]s]8%ױtEC]@r(QԮ|zZ᷿U74ba[taZg2 KTˎO>z朙sI#s)FL3%gm[ݕ] NQv\C;.ˢj ouczo .IG;r6UZb틤rPeF͆HҵPK:wi JYMPKMmt"-s"=r"QexRBtmȶ1jg<ɜ2tCu 5f}DhR6Ih^(JV.:J,Egf0bڂ+Ӷu嘆;;an<6}|J6CzƭVnh~ő1EGJeOgݳ1}|V>{P5g=c&k0vvE'ƥUz(Lj>j3Ǥd|̴=$u̦f_8I|t~GCc~~uLJ'%:@&I{I̫ )x+ĠQRinsHP'FO8oRT3nu_g*# X+ե0PPxasڌbZ-p`zLI}Nv[y(p6]u +Md1_>;;d ݭsgΚYr7(Oc+?k|ZWjTEO5l]ܭ 1civQFxa( nBeB 3ܘ.~SF}4 148\=gNҾʓ&mOs I^G-jj \*>rrPqlK!(eQs ۀ ٬>ǫʫlj5>v tm9DgqJZ-Z􋵇 zq5Fvjogw~}Qvyyw]3~E?0QB +WXX!rL({4Ǝq1*'jUkwTߢNǶv^pE)늊@brlٗR1]@ ",\LYw$E\L'=eE0]T.̹i$rEYMlw9,j(07k4ѾHުՙ ٱ)'j;Z Rxʟۇ}!lVeTKq4 C1rhrM+{Sf 8!cҌyզgTxplFlw a4[3& -G:O0!YTwG8$w lcbI/T[q}yF;<5gFn V*[MoB`Yֺ^"%SY8 ʞa1+,"ӆK.*˻ἈM֖퇺U9!y[~yW_q˓뷻$c]p xRd\ {݂w\3í'gu]'ߛ;eCᡷ0vn0{/_S hٜ} `09wc2 UpmgpuuYOKc:o9{G9լ5MKp٭vaY]wԖR?9Fʠw>&:g]b5bz/9f5qZ, S7Z̿+Qy}5g\HފQ|_W ΆA^;Euo'y1'[ԓ&Ұ6/ηA|yqޤ% >I1ޖ04]m>$DE2/̟Q׬ 8 #:2/Dht=N*7`\5;)Us9O7 HU[-":bP* "%cWQu=W ϒ9Tki~sqomQ{fk[:KW۫v]~Y^6.O =׸cW@\񾣿dacmηC :;о֚̉֗3L{ӓT0 ctNl*@#T_T{`P,-zm.lg$OloH^.y$7EM:di -5jS-t H7s}pnP4E҆6]%J& M$v  4sԲ#L u|3Ͻ{/SǤ!2.̓l3.BrC#@e]'`铋2cLD7NI:trvZ~inxgǿ;8zͻޮ(Z0L#ꕆE^) sGe&_Wը4h@gi1ʗBѥg5/U$eQ}pC`C 0ZiV8;`s˜yGjMM7ΖMPb)Rzּѯmaow֘$JJ)=1;Ĵ¹  84U{&N3W9 y vzv /2idڮ4 ^ CCp,tj;lO \Dj R] c'$_N_=o"\KA=zhLzSb>]#1TH%PzHqhhP1ϛ wz.:4P:船ѥ Q"+Z*zUu h}vw(ѢEGF./nڭxı/-~W̆>'|]p"?n?ŷ=kk,`6M_tI\η,*s%ٓ=K}5X沼){k9Tg-ރç7w5qF>RG^ _Jʮ>H,K\EmY.=&()lhݚkR`U,aY 6$I@#iNxjEU 1CI4&!aeqҥ33/?+0v?(69"`DEVRz}GՁC͎Dh`¤t j2̞Nm\vIuٿ~$q@g4wHBs ~mn~D&RvQٕ}E_wa1 ةFedMV$~:4u6+M4;JȯK%AMc]Uār5ꑎNQs0N)73Kgug94R2+1 ;u8u5@sw$\5;-OnTo/koRBjں `/1gi S1ǎ4-/66O9ϫ[zm-5i+2B.ײ%6ԶZU%o;[9if]%12ṛ '+I;Ͽk&G^MiUtr Quih:^0".Ed'u-|pђkyHY[86)x;\:kH- nwlu6SZ= \S {/,_4C.yJ݌7] m̻p]Ĝ:<;ϹH9cq.ˢ)U~oQϖPG>ڄ-`4sK`}c#ѳM')e ?Cӯ[[hMȺzNN;6;]]MDzejvR m/ 锼=}kءKf9?(T"UR2a`sY8а$i 2XSE;^0M1w=!0rB^L}x*00=G-p=l͢wn9Y]N摛&SK/-;vA]c0О?pPJil"J{;#E`ır( 3+(y˲ ;Cu'zOA[NȊ!dwNklszɉ?.hWk/AT>5123Yv?1 2s: :].A+ ]%>B3'M/ʐA $];.{fճ& #67ߜ㒔W߰cj?@uVB>y7 fsO?mvuklj*MEcBE:QmDEpʼ1qUFG JpmLfQ6wwX*Z1+s6||azU$P6 h.(ӅWT9nW7B<;?#u8;+>3wȳ8ˤ7&s"D? T;&:ajJxx.w`/w{v[B!䙲%]j,wy%4NJp1)ljA7Մ;%憆@QGWݖCёV&QB5BbfxgOgMX10,Fܯ;!InqN!FY it:0CRV$|]-Ix!r&jޘo-"K<Ieffa2J EEHmdR ˔D(ǽy7kiKj a;-n,* ],)Wj&Ů ~Op꾍IDATh (Wr03s&i"z ^ըuƛ։4pE35zqp$ZairlK*ZZ`o ~ Dn__{YLLF?O8l;Sƞ҈=<4½+̯3ROHXWbQ5,J"(EE"b bIdf>дFo*=Gk jʍ2|ZĨ/ц4 :OMr,KDH"c'I'"\!`wciŕN ǝ &5{Vl@1PSQ߂Ihlb?ؘ<u2|?:ܩ@4z\As,|rk_O([JCR#s.$.A\wy3PlDxe%";uu w>7C$#׹_Od2xt^\\ZLYQa+f]<ӹmlkDt޻a cdXzI.n`xlFI ^9>V,[zsQ Hg,\.5#c}ǜM!# 6cڰx~ϳ2J\͙R'Ιخ^,͕OM+mJt%`LpsXY 6X81rA!ƍiC=7Osl}wGVahTvöw;'~̚5&7T N w@2C#@'j6ݔ_+_-~&ko:,'r#c_2zOaD&sҼ\2/9r?^|P =,l,.πM2@[gUVceKe&GҰ^/6CXO׾J3 5Чo<[6r4ݕG.a2*~sUnh4eOTY܇AJlGgZ(-ozLб' Ĉ0H/698VZaAu*Krg KsSj3R?n~< oF: i CFta5 J_\/Z)hGL!QTf6Ȧa='Q]G;Ԣ)㳋J[zvjŪIZ"hwgÝ2nAjh^Ns({q#h7&lM}-M 3ڏeW[ rCm@}mv=/-Ν\ېMA~m}"R)"Z-`3ޮln]"93RN/.M'Z6j*/$.MrG߮*q[_=aq~7v =#ip=,6"` :AD:aX8TYQ&e:GnQ,][pX=9eV114)`ncVώm2XNg*j}ˤbsNv7itH?V^ A{J~#bE%Ā kjw.Bgx.1}lbIlaXj V>F\(\6t4ƎW{S!fQF*͋Og..~yqޤ]oBbg˼cgn 꽆dD'BhU&bw|v(YSHL6QTz2a?sjFNw4%ɞAU[+¸scQ/j%honS&ERFf}9D?$\DT;G NVBӯT]O;=z5 _kZ2Vj֊/1*wWZ}_n3;U/[[JbcC39N4z_r6ZgON7}L>UIG@n찪a2 u1ٹK=`|vC,x# knƔdn5W |n.XkQ!|}q 3.gDrisM4v5l{\uL:% B1ؘNԃָbU!8W y4Es+xꈸBp9zhrF~鐑]/u)/3<*s(wvtTeLϏ_<33~g%6,t6YSӨ6a\ W7Bj':R]4ֈ/R@np'~ KokxtÃy* ?g˿zlеDw/1ݐ+czZ(A}skAnоmEge:W~0DhrjDJ<!QYcGGe3Nio;;^uE _Dcz뗄j'0&N^3b2S{2hTd|ý1Wܗ>萶j8Ppˁ 8zRlY6{>VT8J*J@|wu3n]#˯xtLCmמ7p4o9u5|\'qBw[K>3n *'0àGRiwT}oR96Hv^[\M^4Qۦ<_o}s~@o(,oNU},9g5 JE9HU17V6{  p6vZkCܘ- Z9l#0MˍM5 /pu b~>8gJr2e=g+!YRGy@.j}3(-1O̘yvUԪ8Q^/$0!IAHvoOnZ=~(/&#SDGm)W BlG.TknvɈTFR\^HV04Lr7V&@VW N''OMЎuLRňfU^jne͊UWwި#n*pkƏXbNG\7zCv]!rIS+J*8 Ţ^깙~aJ#<{}d!#ƤOa^4*-*zoIm 6;`5"RPHj?.9[JHx 鲟ʐ +aᵉt *57id9p@}5b(ΕGw\&/L=g{_I˄Owi|e; G$sB$h6irM{MgOHǝ}Dž*SLjj fiPgbS|A T;-Um(lz<&> C;$. gԸj[skwTߢ馝D7rfi"Sý8{ T1cUtS1{\B:r/Oi2NhT~X;kDembTC,jTL5} %Ҙ3q"ٽIcG=\u$r'w$@EEu0^ (|Բm#_?R١`_T1F#Z1AO!5Zŷ\8 j^LY> .^CAt߆Eq;;> d=8X#*F׮2{b<.-1 3G"=Ψvhȵ SK Oߡ֍iA˞k&)~݄Fp@(wB!)~[zL d,G6%6OO=u zA7LCЍV[$ѢR};&_Px5zkqzᮣچRGUMcpan^KhH.igH?++ˌf(Mp͇IGy9Cdo$ 樷|S =ܘ6QF`/mۻLFep3[7 l{X[~R}my  H~kԔJMΓd=DTn(XQ nĶ L%~GOTop{r ;^mŤ  nc!E1c!~˔k}2׸^̘~Ʊ*ӳPqBoAd%(2nBc,lQ߉{ŅՉ{# k nl; mߔ]K2;/NGV0#) 㟵Ỏtq˻:H.szj 5u<Ս)vBli(lN._02yFs~9xnZݨU M[ԴBR>`?wEs%,eϺF )-H):8wr1NIO"S=\'oX\=k]mƷ_OT;ؿVo5"6f+o}y#`ZWoK;oKOϨiu3g]NvZ#. =}4 M#[pL\"llcY VŃQ596ZLJK3- ?a2RJ&u{5U5CХ``7>T;O]? !}ŒHM^ WKi lh1 |Y\T& ڥFLEƍٓSf ;%Ik~xD8P_G;VK Әj84+>ۄƮW/2H6Q1bm8ݱHEC"SCW&NR(cNzjrUJ  (k~z<6&5gƩ} )x\|u\ӑǾ!щ<TULf3aE5Օ8v}iAre{m" ~ΆRJ\fp lNL?_6gX&n 0i$T;/}@D_o:-3iUIih'T;nh0NYK-ݻh3b":%o>$5.6ZI͙;潟\uvZޝo=Qz']=8|zsQ'2Ԟd9 Rև/e3*%sϾUh|Y]᳞Twkllʶ?'5nړ&iwLlK0L|Jk`EyvDUhHpҀ[cg8` # ĥIdؘpB% \D{}9-4E8'.r`\39=!տv'Fe5;4Fx:m& v! 1y"eӯ~*wtWlLtтIym*Ͳww}+24E@C aQb/d&vO2q =#4kbvf) t7,d=x2.GO*b& SNGN!+M=jozE+qS&EU+ͬC_+y~5JHAX e7\fS9 ?gDүܑP0lg琝1-=k{i_tJȗb{!-A0oc/FٿϘ nT-s?3Z?]eRwd4 y)frdr>]" _/0_.3flrcBòډAkT0*_9ubkIIˬvWZ#. M x0vd\Z9O3GLbXOLgzp<`0}goϝ hmNk|zjەID "`I.^0w.C~ꍇϚ:ǟ|x(꙯Uy/ݎVeeٮ3o/N Aadpw< vbJ1v$'\tOktJ= BvgCԐ bJ[aUO83?D@sLVa1R-׷ܷ\w/Z1'Vm1vI[[~ـ5xe֬1pHg*t0tNxV<â)ݒ3r@/~{RXg-< n= 9`56~{NT;';>'Ck}=V  pa XG _F_r(!khCMEFRQ o؄͋OJoqɱqLn?l91_X[ _ll<3X->:rsWgll|vFO[~AX!o2ƘGO~P^ضџp9Ȏb679eթ/S5cfP~K\v&Dҩ^mPs͔{Mqr,/[r_5= \['5 Kx\X \&k|bD%B0,&an_Co)Kl =Lyv,8;wE÷=HC2E\9;3ͧNZqVXn$b\.#1M՝E} /k<5R*^#j[dPM-WlUvFvXθ1iNdÅq58M^>1v_:Wj0?𷬉7.b^ǧnZPר]ByiKð]YQED Iʐ0Xe4i/?\:452j9C!^g4>! x4hۤn21N,EBMy6D,Fw^=_XX1*֢^H[p`׀OCz>,`jJ%3=xͰdE^[=4["#?f>P!hoUi;%CF[&7/e9*.̑LI#n|z6nI1NnvӞj oHʕH8uCG>1vůʌ:y7,F۰1Cs7 2Acjc6NA:^.搑 N*|)z3eك2VmuĨt)ՎZ#")ą@Ě 10D 0l(.0.״~be)x`h A׋A%Z/\4|vjJgo3*!y5jT/ S"snhh'Ʈ􄮙.ڍj.%6Fwo(+Ϲ״6N*:D;7??*(`M̊paCFk#Ri4o`4cnP[}wM5@:(Ikþj{6D !E TQǢۤᨓ3e(;]Iv1s Nt5c7uDL ϊLT]lDҭ9b}?sKδ?=I 2GĦz۝ќ~pa$稜WZW=6WGӶ;d%l_ODؘw_83Ƨd-{Hދ+))o|bk"&WF~zy+^jcS aڨ^=w={kWZ#tN\ֈS _9 iuV@$,N:>I][-ԇ?H|ec{lKCj.<3%~`ҁh/?YeGrI'tw(՛;!ZS$&D5ڽMxiUt]e6N,$qgCOA΋/[Z2:7*d٪8Ѩ./Zu@BU}ٹs5[EoZFwƆXzK6-lX+_sE o.\24BÈwN'6YĶv0nFJrE'R퀡3w`Rn<>Z 6[ *I{ &e & 2vIqRa`Sn[V7Mox :c0 T@x RQȹ۹sYUWѹli$<{qUl qh"\45PZb2@{2 ׳ =MEd^FYz'tl+ˌf؁S /Xʥgɑ\ƅ}ۗw[[}*FAśB{u{5US޸Z9GT;yb 3i];תF)|v1%;ؘ7:5Ys72/&uǸ zKNq \T1*.z;]˒PT c'/38_ѪQ?հaw]s[~N@x\~рz<Եt٩RHrӖЌg1.'˭dTք{zgvV]'He _zמBK'Λخߘ3Ϟ:ss< ,+@ܻe:J)MKlKU*HfҘGON eS47^3`[+cLOà#q%tT FPQi{äҖ8EC+o&Dwj:6i;^b! P,qL1+},r\BVV;h;ԿjgHրHamHo %悟D6kff(Q5ǿRsɽ.B^ݧT'f#%LS1ύNIpK=k-|pђkyHY[86%@w+k5V#x4ɜq-#ժM5MZƍII"%kmrTdRb[be.Xjgs;dCE@gM˙gŦRh2ިv>yʳsr *0*yLqYDă啫VO/1!A Ҁ c޽ w4,8+q4dOփ\$lq:+E*Ǥf0xɡT.1U"PICV*J} =>;f$" &ccgD"5B>:lvE WN\v*a04V)=tӔˣڮhWM;:LPj'n`jDn_p^fnn>l͆j TZ['~*| }2֪FmaBItWΛ%HqdlD*5`ڤ{ޝbʒfkrU "YtC{Yu8S 8jY Su^BUwaW>1vHx0 ː^6.u?ݰ4ZB A+ûw*pc[؟& LOeW}Kn('w[Ibb On#`:P+z^Rʊo?E>Jl>:T;lVNv9SxUq@?i'e[,eݵ$@gն9EA%Py'e@.:. K6o6+K^gL_a| ϨDRz a(7΢v˵Ӷ<\VA:Ra6 فM!O% -:MWGD39)5zsoRsI7xV a g&ی *jf4O(PhX.ıXw 0cuqpc0DRóЛÒn`˷Q mxXM.Be$.PWc+3tyOjV訖{o_6T5G"g QU4(! ʺ:*0V>X m.I^8J>hqӅi8KȰbvw!ẘ*KH]B<{3&eҾ"ﶝ72ggľ D}b@%lާ"ѸԀ$ڛ6u/Xѣb@#$MWi/'Is>s%W@'`1o%fMf^}b.7j+;&d=aԷ. Px4o "zy!u\艏D$]_wehciқEI,/QNehvkT Ԫ̻NcW@1Tm9@GnR~Ms·ze )!Ra㵌T!oSr7 }0am*.?WgNkt}PHdJ }uV݆ t.; z4hI f"EARWL]1[%N>^մ}N`[G4*!6mĐ }Ӏ(DLGDy}i,AڥfS@Aݴg;n!qdLB+x95ޔ1ɖq/woLtٓzj ?ڢ1?ԙP>p\\b+pf\-`$.=Jt5f'^01LB+uGm_qdriL0Xޑ^VĮvR0\g۫遖B'$ 4m.E~0ݻk[NتLGA# (p8b-犢2"zR/^xQ([ѦSNۛp>|V`xf8|YMocHzs^8T̀t84+!3nٟV >@JttK x{atHj7bO&}4"Ǧ\UTԔQ5{Ap+֝5\{BG٪(?'8=e"|}pR%tKH]bo M$G: P, GN]h^`iFT~[y5 Y%74a_驰&΍R QWh{Ret ŋ>Vc]Lyj})1RpWYsjuݘ9Q %'턐>yS$ -O:!ٱIs+Y'kU zg!_G>Y .έ Yavb-Usڤ sκy*4"^dwRpOfm@pҸꉤ/.K3mTj<,rocܮA$2D2. \ѻc3g^T:B] !e6=mݯ޲|+cWF ?ٵ^އ\OR> 70+C)fO"= .7ylt䎫&3eCǛy<Wl@xBTR?zx ~2|I|vbܥ#;8*"#vtV}b =SlzD:BG HPRsw^|v;C$`7)Xr𩫷@R}QN_GnE:3}Ww[G{F~{y%$x*pCQC&Qx"VdXrd,ێUΉ^-K[5!9!*vV"ig9Xm13Eʿ|ףiw $gc.WnyI)Yn?ypv$K"_dZ,F:ߞ2S-ʡikaF,;o,3J LHi3vcK<^)HD(ֽRm$` !Ŭl*jl+2bH۳0u'ؕ"?acWf 1vKqq岚ꑣDnC4πHҺS/~ 8XtqZɁ3b odQvf2>yiqO8n6o0d;D`WJ̆j[0:^)O5Yl֥}؍l֏Tox[۹]PfJ᝝E'gv yNŬqT!䣶H@tcRu鉈c=sYJm;3M3SslpiUPF/O_* (X*RN&Vi2Y&59A*[KƎˌ + #XͰo}i0OO?JՅg7+LtI[ |Gzouީ2IQ_ӹk'>Jˏw&EgqU։w^4|ySb3\>ez ]PsɇM]8y#;4f]o.|tُLIyHY[86%&18BGX$IթO]n=NdysOvsݩvKKZRM˱YDVbI *GP.͙oXݘT"RkE㾞.uVoMNq,Qe>吨<,V JLR ]D h0~NmDFteV0w q mRoWۈIQ;3U}XA~&ߠwV ]o}$2\TeeҩDCTrxs4vSO00UMTsBG+59iKqs*ޙgYxdY"39bIJZ ͑3ORy[KuIևӥ-x' -m#=`2cWVeV6E\xK+l^%@E%Z: <ut7˸e:I4PaVwYStn7`dƢMbd]K=Uf0S@:nmtHrM}1N1V`Pfc/:r4vpV 09v v+ebԔ[,;t]h)m;a<FJ9j;DiKK[K]ѠoMEz8fdzyI9{a<ɃyX|p4 s8|8y\^p=ا{QԆI4Z v8Pq_!;,vDJUu8v; &*jW|Rd1:.r K4 ~np7n+ 85MLw|Z~jxBVcnv,ȍt+.:n@yDdDޢJ%i*SyOr$zuw8}TB2lү?`UWSQiKgO¹߷Bt@h?,ޅ#*:H &@,aΝ2T|Pne16,j"g|e QFW+Fq£.*=K[Z]; A엻0. T.Jgaf`2iF (q<ωxk2% 2ni>Xj>e6ޭj&23Ru$D iAu<ӵ j0u`\mcMk(!qW\\ƈ,aW&~5mM9dHևl[ "@g)ƕ.-&ø"GoQ#hlSr7 \Ce0˲JS}Eg&fhdrљ:;c-Pz.woL{+1 CZL!ɓwvu^5Mm>+Xxrʡ-dg1OoTN>zoVm/!"t< wfɋOﯮ;peS5}'r; &[- >:ccY[^!:H/t_Y8HbW=7v7V2!k6hlܧ8|{K8۸*#u/Y+= ( @M2wo{6ɑ@Bz2/}㭷yc bBf_Q9,nLz+4`KD/u`.FjQwyDp3*EM^ _)N2kבN -NL p*`VԺfN(~ڷ'U%l mcfwi#Dd{&,f _1l#y < oW< _s=>[}oZAd!l;W<;MX F N:"l|fm 12[{JFދ VX|:~/wq1 }Aj\NB ěwylFIuIN[BHU$q ,b yb{P:=ҕ?uYm+<`z ^sy K^ܽ9lSQF⌵ vMr)$i$J̼齝:fڧeHO#1N*961Ed/Ӷ & WIubyvUv; *()>рYgb`j)_2ds;4l wx(衿n.99l2 ɸ͗nΦx&!a G!2L9䖋N=jcɫyΛMaN;:Q+`)Z}Xz٪sH1]2iBsVjD&OZ?{\B)6:ÂyXb f\';:o>?!KhM#Hz .?3W ޡt1Oʞ\M:PQ-{`XmllD^2=5cKqKK2ۣP \U\=.GOR<=; 'MH*Oz4ͽLfCmU׷4xfԌx)f;CӶeC=zIؘzawU[VAɤcN :ڂE<vE}_{YPw4':~cZ})S1)W3>ј}i jHkfMk`X3'oc)C+B۰ EH41WרԪ(75w=bkDefky{r; DZL}/G0;DRzDlnRn-d3uDwhxS_*~ f镖xX2R M2Rla &&=psïIyN,S vKFB7jDZzRTMzÁIӔ zGRX6k܀+ggyGkT-[6կ.:AF9_ ]Eش/5N5͐IPэ wZ&[&zK?ssoY3~;"ͨw(37#bbҫZ(]ؔA|Q}569-~Ms3r0Hm-m;ӵ[Z,ۮ߳k< 6koCT;9೚0y#;4fUo2ăR:r\Bn⩭I gMHJ3-kv4Z cWתE|"OϱoB?k"fdo9qW0l1Ev;TpFwB4Wk}vʠQk_ (9i-?Q;أ٣1{ܰ'ThTWN'Al Y 'g-xo%fq9h@fQ;tw\6hNs-heRH5Z_~`(+J 2swl.T=pCge$i(<ɐ\RDM?~)*vRry%{cr~rP&8Q͓I»DeQ.i Ld\{;&[*)-lֻ] 6vސ2 잽%sR2NpUGj//ΛТJE[:Ó##kj vL)7>sp/&KJQqiQn`0 +Jk&*rykC(OO3]}#OM+mAG[+6d3ؘT{ P'.[X TP TSEtv~ ^V60 rQiI\ N6v"sg}'^ wM\!3~b~O[ `caTm;N/zWYtv IN$rGK'jݝ p!q.]\016ZtX4IGy2Tjk͸鲳e3u8VI6<r&tqas5X4_WO`zBC N|GE Aܭ9F30uG 6vP7<'^._7&lcŋ4FSE1k|JPLk/M+@QK/_27L]TZ§~2<W"+QMG(^o %#7Mq֤U|E &/Giɕ_& '@e7d0ƒ}go>r eOyOq 4l8QExAn7̎F&黖X'NM?謦z(R%'仫s'' j/E}%k7=}ݯ޲l6'~]Α8XnYehʞPeMNhǫGݒI:+,ÇKW-&ge!-N ݷeO-uDtr9,PՑ ɷC>^Zc",=Asvza<;_>>r` <[N;$@H{݉T~'{ 5fSnVDRU-7+*Ǐ#˞LH?\<#3Y=%Xҙ@Hebs.aUjàmn7h32NRԕ,QѨ֪-`k7E^_p X㖝w$ܫL`])9 ! Ǽ8[nlznj,93g'{86Gg39yط;0Q6Ŗ!*K𱚵Ϳ\1+txnTzٶtkkś]SWnW5GC7* \41;_{hqԵ[kZ{]mUa?"х?@ 酹a=@F-@M i(.Ipm.q]çPC…' [mSٸJB^X0Xvى{>oCL $p]Tv7U_'%dDw)$Rothׇd2xxǦ Kx=sKδ?=I˲FC@)йwmiXvpz_ܷ 6dvVQ%Fn 6=zsf_[MDQ%3%.|K٤_Nw_$/; =GV*=I(iTUƎفaJQ5^=#q{-TnLHp;݄ȄǵwvLwUc#[k&@ۨxZ[N\λѕOsZ CcқMWT"й/9ۇ8.)Y;˔pޘq{MRfи˨!MQ,; lξ[k`q˯=d]/ 7 T4h9={0|w, CJvT4dzN7eLsQԓԖxSS6Wmk.Q[4~WG|m="6&6YyWb%JCMyv+=)o!FЧlsШ4i8-௏U Dx.|_K`go[*óSSof{1grR.H[0*+нKvژ;M1J!'*K|y;"`)e%GFGI#ѧcrdhhw;'/n?4}dR{UttSFdĤre'@ HݘP/>^[@phD|P gwН U .6|${htg@ } OJ.ˎ6ݲ%gxJaG\afML0=w+5-[!͹O[ ӟ¼.բK3Fr1vBPmQ77$"jMfՠ4Yܲ.|CYUW@`ڝ-f#lQ1$Eqݙ a@fA7?'w` BA}u/V_%c`_1I.kÜ=.!}bG?Ll섟CW[,8'>{S41\f Ѩ!]!8?ݘrI0*_N HjjlxN@!N<_?=qFV7jUCӣV>50P|vW7Lo{;[c}qMQl'}^]lTP{ItգDBBO|jQ2!667*᳃<;+>m+S)f#ti;*U-xåL4eg]J:`/]/^R޾U(T.Gpw#~qV'ssf8?[43gږn\ȅ1tBgsFH|vf/$r3euoɵ.&Z"u[hTd=`ܘ=9eV̎mF͖8fX'jm㫞}ݎK"3=q A)H]s a@r VOFr: ̻yS2 fvŒez}Q۷:蒬 $38H< ׇ~"}ޘB5Ǿ!ߛ$.V!Qz.ǯ2I Sg0" y ۼo ڎ/@lcFoڿ;)I[ND2fgYB@ xy>3]ݺwȘ{ެ'd]e:k_wم{nk.FH,{Wl̙]o$œsJVmo_%*ОܻԾ-W=yP<(!H<Pmel)?*rϱwF&><雋;{롎ւQ zaSq{ _D耷8a5bȱ}L:"^QJ/jIp:K}x:읉 u#![#c1 :"ܤxYDmN뭞/h5x,ZrM(l ɵ b ukpuw$!*obKn8 Ǟg 0.~Q]}l 33w.|fgr 2vIqRĈيLլSYYßI c}Scͧ f8X8^1Qup{;pYR7kw ]fV}ꁯ(~i({} =SE )<6I <Μ3]IQ16uMne\\B/aAm9ν acݑ^X4}!<<& -GI%$ֶBn_++o wv6":㞷O:en^B*"[2ɼxdؖBM788=.(=35 N]`0S1w& ss];Eu_Gٞ`c!L~yy*rj x2daijR+Tq`?n}oWpq;wY 2MdWtHCtR7$+Ow˾ЎE}m)dyN9#wI.q0U.PƝXa8a 7٨"g!; 6vb|IH?? s 20ˮE- 3Ǥd|Թ=UFB* oKdP7$ na ]fLB2?t| LT铪 rѡ>ҷRȢm[[ݾßmx*swldZ“Gj//ΛТJ*3Wf+L !$)iې%Qcn1oti39#;.l{iW0_$Ec55xjP(,"U$S8酋ibg8 |Bv qCb2?^A>RCmמ7p4o9_|]κh:<E"~|*R`檾U@:_zC*V(ܙvI>r 2㫬w?:16:KqxyL}[:ɲݠdox_$EV5#O};;EڡW?x}p/JyT3hxS1PV Ư% )4uA(@wa&_r4_.Mk,pnwb'iKB !.0I8rѐ/`YBM T&@M!DLָLsI=?1E}^[33،t6y-Ny#k5,g CP'tk=#(Dh²ΙLY;}trmH/DYw5|]ch'S`ue l0a HqbH C-t*c}v YL~9yJz[qkqs38!.f]I ̭Ǎa/ԅ0lʼvsXlf>v]xqWwB a!%s֍0a85ns0 àˊw(L/[UwpIY$!p; YCM!djUIH=$!hDmWI0}DԠNsvQi޺w 1]\VlmqÑe  r3vbg'$)!oUhTq+RxS;WP|[jԮ\Zb ȮvȜp,7[co{-=i0? Bn<7uKHǹ墎!hP{P" #go@IEh|xl~o|jp/(JG Ѫ_:g9XCJ/;Ywk-+;]K/6=~Tp{/K$2A. HHR4bc>q9pF;1sQ@(Fd7c,HXı|uR?niHĄSTw ]b+W<;QL.F %͊s5LeΨ}o?,&fn<\f0z?6hWAˏK( Ë[ (e>0v'$)U7\b Ẻ05HuwkN}T%EBG hdlW-4]ޚK^>* \㭜dQ urNAᭋ~V@ z_6tˠm-&+%flwؙZ6ҏuƌ孽o~U3|=XYGN֩8]&NuT|%AQ_2d$lt`@UR{;? 5%\:u*;3705J~ۀQMnoKiGFG& Ϲhm#ثb!s؀o k>HAweL _X_j$ K>Q5cf_G$',8pο).AQqĈSfvFԞzA0]Mմ 7KnL/^ ~:^gLkֶbdh[h9l켎GRrg&XZ)~ 6۠̈ˍUs:M7Bء̻ HN=1eN}FV|=׍wkXC2lCcǔqW6Pa zS}rcGs^(_=1f/;˯2GvtY`4[ o7*Z%Ce=q4##?6h/ق^͈i sjTR]1~*RTHx~V qٜ9g|L~5Y%a?Zfݗ?$f]\rjh2^OP{rzlxwl|E$zE궘"#@۳pۮS'[tW3s w71#jkj6:͒FA*Sߋ`H4c?rc' nY9`Q]>z. )-]\b?t:ow䏶I=%ncDMs3r䦏JH= ë;A<[r`N*}^]g~Ճ GWxuţ Tt*N+7esuYE?sD|z]A%X%Fpk3 !0nïo5 'Em_[.9Qr`Jaf,̂:n8ܡm:Ų/إpRZꍕ8އI1޻` ;~RGĒQĿ{ETQis-N\hm*6&F8 ղdUybkhxH%J$gʔTv9D eO4.|xĬ^=9T|w)S#!g蘱>&a?')k_ݱzָeE;W+=pعzQb z>sG\]f{e+[WK~7vHa/ZUճSI_lU6vLTxN 4 z BW!{ݗ`u!.{oH?b$⃤kjls 1I4^]ͧ_.a؝ `:>sĥը_}$ub#"FG*I]_9ŝKSN *vmu.?;2+/gN@:'qݑ w|* zfӆ'$M~!QT|̵4go:MO&R{`TgC yNCA7YkW.;KHh1GcG.poP&"F &Jtyt`y+J^W`5sRg|gf CGu#^{xd{.E< jK]AaHo& Ub@fr}^$V1PE \ݰo#9TʈD޳-f7pqP\hꂻ(-wg.n PRqՆ/r:ʇHPg)Ț؀Zm~~bKpx .EƎ(BXUIUա6,Wm*noFsb$-k}bYYx$ИX'p]hoozwߊAΈ^bwT훭sAt;.Xc, *NDy*$J@Zpn9ש(Ae9'lL.|цܷJ]^!ndLYGE$\LܒuVG$!(a7H&W𔲘MZn̰`a7t,5[_^7Eכ| 9PH$ {* ZT/ZE|S̗@DIr<uW"}}ϩό=xCΐ]6v#.Ϗ譜QDr19iWfQy'#VSOT_[e/.2oGFy.iW{GFwn<*B$虂Hz|s!ގ(]g ȞyXgez3'g7!X+\Ќ̀YݨU M[Դ͡{_Jl .D'L*Gw&FR iSHNCwd.WSL,"l8L7S0&}wv\5 V<{+=ѭ` ucV 2Drb][K{!Hc>R&|˲.YtEs;̗ tfzaw~9ʀ賜ayoȾI^} Ku>-Kk l~(*C~k_*Rb)Qpl>Ъ8k|iAk1[3$?5we{5ew}7pKƮ'+)"4k㲬<eaPIYA uCFvv' ˅5@Xac@[y^<^ 8^?;W]cBSںLF{7g!@; Ћ l: (*&餁cMI0ɍؠX1/wY/,STQ֎:CI=]S VouwgFc32lAĸD{ NR oϛHdHYK.IH"ze\HftHL [;_]4@P& z+.'CM9(gVo=Pq Q\|t:)AkXt 'd'W#QPC}ʝg0 [o,]'m)nmϦfCC"tl\ʱњMzGȥ9?EcE!͞`bF-߳h P2-#x gll|vFO[NUB7oozw̑ڰ6|^,Qx{,\ i lk=1t %? ;'>(!/dh Oؘ| dq9vF2?;ZV^@n}pk4#5f>I;1Bvš&JD-lP6vηٝAt ܹȷ&*XEOg4<@oR8v%Z;Ý:jPh{`A`F6uVr1m\^1Ey_޵4kIZ[s'$ʢ^O}REdЅye\H:U#ElR צNH |R\acsH𝑂BM G(tĠ~ipa;HNVt(Mg㮪ǂx a޺V_"}~Pȷm&%6rz6d q~ac{>èy5:!r|KaA]7`'F'NCówEͮ 2neچ DZ!}F _@F>o-͕sL\A>OM ܩj8,KtAۆ=V:l9NiZ+bNoa"]d1B\`F6a LYc' 7? ~摹$pD( `Ô}2k`,ڷ`t`}_\pԀvvyZ^2=nf#bjSD ".FAs/ `Ӱ,- HK͙וbwX.nT0vkxuo/76,(s#hL?L嚔p[;67{^ƠVRz]gDTbAE5{c-kԥ>_k;C9p3 wBndl$-#7 ɹfTjz8ܭ20 =7U`İ8Blu"cR̲8*"&Ƀ6((O;n{JX&a^oE~Z+i0vB' QBО2.`RYQv׸I75! bP\Al33pe!F46%Nf@o$R|ntƝT5pZ;<ÓWLbxNq K#Mh `NzAfCŕ*:؄:xA٩1X7e$sQ5$ZnM2A$c}p`%oOH r'!')\2ycƆ٩rxɢR_qw~ۅ#;&-J.<Zt._P°!׺{^=^~ipBhbJ(EK疉jj5zEr,ϻ< X_ZBÊ = !7vA=2ۙ̇ԹW,x$ qwg0ZM=dܺ+SP[ GN7& xxh Ftq-и&2Rޞ+#S_rA7P>(62lLJ3SbH 㱡v>BKn5_@!e@e˔k0r$gK%_ըm㢯n~q64v\:iڕ7#|L ݴwޑbA M&"K ?QQc(.ebgn׿bjԃo;91wD0w$u APli],e< ˟_sr{qt/ /d=G&u-)ZzQU(Kypì j11*q%k LqUi%rO%<^r`w-x{DOFL܁~}Bzh59vNq{I.ŦZE(Hejs Vb5q唈d#Lŀ.z Jb29yS;954.U? 7LȋOW#}B àMKijթ FHR1ʁœ'"a f!]nPـKG_vXetq|NĀJ=qT鑝^5nϒgՀ'ɇJG,c]hw5[HMEմSOOs耢aԌ^,{}C*[+*:) LB}NP@B:朴hHzpB"vԈrY=(U{#fvS:1_+CKwJmz8jqv6hpq;=艭/S_28uꯘreAfU7PȇE)n cMdh$n~޳Nw.LڂP^;!p2=D@}LRAQ Y)H$K~C~c&7gCDz'u泬#PEG接~;B],eHZl=B&/n'ycg {ϥgdduم6Dn͟t@ Clu~o3̤-c TgמJ&csqI2 4O2~/ϤL>M ; ։کD*멳XImA.Mru*Q3D>zD3~/ȷ/0ZRTt=\wc]ٌ /v^ӵnO;۲kΙ󐲶plJKdb8Cyvkw8b`vԁt&?DPQkMvA <|[58Iۿ /`haÍ|G?qbiDn=DQJwVC$0jÀfd@q! LB"f=+zS2X>grV1ف9椢܆$eH @BKe gT8Fr=1tY+.m7zigNf&B"ܘ6ϟʚ:Ҙ#`=M@ f}n ; hFl!xv$tHt>;\ucVES"?K"@) JOSA+P` 3u+hxnBGBWr,(Vf+g>m9|x&Wnx2HZ4dW^LD;`t|Tza?pʙ'W=;d>fD Ctc7a'Kz &~v?; ?A0zmXz` ДȜY-M%PoPA3y.^1Cg .* Hh`E{7,sjYm:v[Q&3I/gjvS=P81Cm΅D~Vz ^옉Ur/&&kt:NBk㠂4_ c8Ieݞf-TAޙs3 A3>^zG5 UMg$B1YKrJS蜏&gEv L6H,ljL Dv!uz]ËR5#zLvp dx:2zΈCSrY1ճs22j-i3>X(;ShT~:(ۢ~C/<p})ҎC 3Qjgڡ̴ҷ ? IJaHm^v̬ɩr&`龂c~ۧќ3!WD+XX#И@Lچ&dl0܇ˀ=ܗd 7½~Tg?>>#b{%e+7ѷ4 S,zq:u<扨fCs%$ 4rXѷ]ZäLFlֽS+*]0p|AS7*x)qEA@,NT)rgF #}kHGkn1㗜t5.a,}Da<”\ g\HyX-tL@Cvqay0!.bCc q6(!D}W9m\&l0F':`MSΠ~_8] QBtf.O8(xl@ʌ] s80b+,[ oT*E ;`7O`4 ݳcoo=W|̘C0?س #d-T3 @mOiC0o߄=V6ĥ0Lhldƣ v+EIE@f6П Y r|S± = `6*{P:.o|..jϴ)Y8hDQ 'D B/D pjkynѫeTgxvDxV8;TJF3A ݾ1+ c,-ZàyZS(!})PD8)Ҋ६dzC@3Jᆥ`~gh1Yqtd^iF$FÉ; C2XA82yx4P PjDž@T;MDƕFwas\Lh `JL4s|_vBodؒ„7>>Smr0ɔަLט]0!BPlR+XA$#IEn)*] DHxCw䔡 )raW?P K%܄X_:3wU 9kz}]], XnP.G:KA+ jvi| ,*] DƘ|CVOeƌU3f Y@TB W*0cQ lОa.(h3_.lRXF *l갚gOerXuh*yg8.)MQ-s %ϘePAGZC~0s$oE!L- _#Td0xڿrLKIA|femzbc6&;DCs'QpФ' ]cRL9r`bֿ~< CvC)+ՍooAAci|'Ʋ6eU)( |yכZIjn﷽ ΔKV &Xg{fSxC*A|GzxuMÇ@ ;NfKe7}rȔ_\om: 1(͘bc: NmEQD-rtfI-\ I!< }<(3^tL [v撹/qpnм$M b%R(Dׅ݌5U;Z1/$l ],b.| n8Rp.C7$XGq<ͭؤ9_-~bиgq ,O/bmRD^bna'#ݚLF ީ͑gH bWBOA6 6ԏfAve64xމmAvb̪)gUa3#Gu|`^9a嶖FAc ib.,I '١9qPpԬg Cf&òNUsjC0Xm: vC}w,zVmjBl)Lb*̉O>Rch*^5;wX} ɗ 2TI Zޗc%W&t1SL0spX]4!cE`E;^dJ&{F0#`rY7`-?oa>~Q!E##¸7ÿ aVX2}wt؅S(хE}Q ٓ;;/xǩH^#ZYaG{l}]SQ߂PAU37nh\и޹wĴONs5"P0’i~*}M7d2'G$=kfH$Z(A,ݖH[~!mHezv.SIN\"cAoo64Wgn)Io8ˏZ- AE2c$2"H Rِ!Ca# <+L 2L0&b)Cv7Ч,?h(ͻKx9N֋$l~kE}ŧstl~Vbgv &9 bR ;'KE:pB!Ѫ ?;SYlۆMd^N[gcA7U7CR?q?=ELQK#9fODM +:Y!=^Zt7HC f"ivN1c6p,oȜˉaN v G?8ZmXzΥ,}0I1BWf]-1_=;KM4QGvB G :BrafLJAS ¢ 8 ͊y*݁uZ^SR> yVH&6#ܤQ{c[_;%s >sːۏj=YL7+?"*X~/-RlR@ ThTGm?z[Y_&T;ÇUoL*QNwK#ͥ`x"SU{rF&VcʋKPs=_2Z$|ZdֈHCcmJ"G u$ (X,4\z5>4jB|D >Bb`~)mjF"].$vazr[9)~p\zbH|@|ŸS.-28ĥaן/z9lྭ<@fS)]eQ'hOT'"gMLip3fn-S ̥bID ub麦s 2uf_zzf749mNݑS]mv(Il(8K B-WAϲ"sZͳUy{9W8;ya[=wJI-آĭ<^^TMq{}SrB`nq͚[thb/ ..U^eh~lS*f(Cö ypKjX4!v{3b ; ׯc6к {118|- * YHSļf$dz~~[%0baWn _<538k e<d4,MZSWnf|bX+8!I&v(;&v^fL&$&5Qb&.~}֓k$ F\:,fn;1.;mp 4.)[SG '0SooM;3 *si(ڊдxepFNAge0dBb=g&.zF-(Gp!qn \03rp"hp ߒ#9oru`Yxl5阄ޤF89dzQMcW~R$QDkTOxSr 5H XRы@ G?(s ;g݆Ώ^ MbXS0>n;N 1cz8h>;?0_H.>HDOĬR@fQsL.Wt , 42QKĥ暢gGd gXR^( ?_\fr0톺.1iM 5ޞHay~ k:9`fO hFoal4 &QfƝr @)dN |[#Rh{/lh˟lT_pR3Zt!'SF;+WFݓ+{kOM*"5׻A|/@Kfe;`O_PãW6 蘤F@ U4q8~cɗGYfUvÜfzEd3#rAE>4XkG$f22gm IY2o$o$\AXja{gKP6UQ%7+q{X;0{d-{Nc6LFӑ}2pa0c.l]΅/irR]v1fȌ85Ѡi(R8&eTΜa݄&175s\FC ׋G/YpïKjԚ{6b,"f8"ퟨ}VHCZQiS[SNUo*@ &k!)~IoL_KFm <|bzWܭ3z7f>uO}sY!lϻQhP99MK Ӫ=YuMnlDRhLd ^T5DVL&nqzRlfe-#bawoH͵d-`B6_Fs7v?A޸&Uj\b01JP4.9 1A䞽Í9cl@MkՎꍇ:Z'MWT=ފ5ךm:VBF)Ԯ˖#Ds<=?!(zZ7w'8ڬ $k+aWOB^Db hӚCZTo 'PD]}^p1YeA_P&5`1zL<YpQXl_辥w5:%,owI *՟,8=ZցkB#f~q~qmhSxyBX]v/RSl眑Ka韑d-شIG/ ciankG[mI!8dҼ2K;]!#Íax'`g c.8r`jڀd n:~ QV"DzTyW;Van(9<tak{3/3>If6@(He1?R0оrvDP棞8X\xKN|!1ZzsɊByA>XŘ䄵rۼNv4?dV3K=u>}R]:PŽ1oo:"뜦K((p_ErIdC,Ɗv@?!1$ l! >vE*| ;rt@G`}zC`gni= T[?Xx 7=c3xW>|Gh)~H?(7PīτMmH"١+:oC/CJzd؈KŠLx ZZLp頄4 9rʠ7%iB 5pv&g \rW4 n~ԼV^6׌dO6'wlqEɰssza Vf}x@S<(2Ho2=)PV XxLRsBONFX"Êa?Jc4ۭo9޸EF0qXwfk?pL) ;&<;C^7h'e_XOϔEO>\Z(=X;8E;GԹ[Wڅ#%mydi` HW?\D|噤=9tCCge3rJ+ *\A=.V`?0R Ř-wU <}Kτl|OՁpV┼VSKwMЛH95ЙV!W/|'eJyQ#F0zb$/Il< %Vj .$SBՠNXW 4lM;g K}Le'nbxrĬ *akCuVrJ.o)P`f}2F&&շ i<A t'd>2odC^LВ_9nmYe dR >A\f О\85kͪ0,51ǠOBOL &VuͮV =2vM8|Y~X_C5е?'u gߋ]kVc!f s87DeM`eC .=TI/&$&ڊ}1x& 9W,'.!c|v3ĬքLӯϲ*M̹]R'Bk1I >&bPu/ozi|+xmuZM.;O2I„̓ 6| kZ %?#ob ovdayrl3 ޸A{6oe Ka0Q"uJ%%7:wbˉ̫u6% hQwϞk:s]oUX1kc-x@Ktn> (5 #fh&4a S( gO!i^|sqތEo7NkΝh2]976#`sf8/)PxB2*yNWseU9K6Ɂ,h 6CiW.SՙKB@ {rSܳ"t]_k8,|qŗ )}c>CBV[rv"?_LY&eҀlU7dA8R ^D쁷 y|7/' fsX׆x6]>jv@/_GV^c^LY\;@,3h#0PzA" _zXzlHse~K] f%5=7{H YͽSԔjX"{8tV +qA==1&L'U5^[\e}pټ0YRM7}o3 {* 2~Bf*a+)?+.,O|ɉsʫ:6ki9!+8iGM:C&?QKNDՐ5Xy " ͢'V`S<}Cg`VErkcX:-{)\mxj7 B@+5m$\6F2DshΆ&7 ;֝v0a={xeA9j,M5~@V|̞qk7dll 6c;Z%%KF3ҟٱpj+u7=x[kg\}q6ao$zOY2E8R[zP)n[!O٫wt5hz 0[# 7Ϛбe._] km>q WYbּyK->;cl~{ )QaCs a&,&M$rY (1pe)-JȊa.&ؤojnP8~C^#TZA9aé]vFlgo>*+2mCW !6w4A$sF%۟)`zaoǦ$0.o8^<_==gnO߄p^*?L! >d=?W!)+OW9=|m;3 d nRFk6yIƘ[vtoyjk)<,sӄY Keǽ0픾KF!Gz!cưKfƁrQ#|>A,a12jp ;*)`xc&oB0#B, '$kut6yuiOF8 UGڎַ>yzf~m8ȞG8҇{wΞ\T'F6i_Ég0Hv'F܅r MJ5$lHWe#5D*k'Nv@}aꬣ(?Kicd%$2M͟4Neߚ'%$^]>nPkİ D4qJs9"5˜G:.HEazujjOиf_ z6?sKOOq%A D|$$c%0=HQ?X Lp.G.t(^ )nDnIlڔOk(#-U%1 f*e60-М*<Zfzz7\ڗ/qFq*$T?Qԗ`174ǧEn޴7AbOłJ6h=ܢz !,¯d*0eP%?pձA`7! ab]1Qũ ][ƺMdAqc ZHwDH 1 1fM>\\0`7-zHNa򋧦7^넙G(~7U`)efǏϟQ4Z{c4coSxqq3c10dmk+.@"?SンOgxg`&mE q(C_0DjKrs&әOcj:Svq+HM?~цPVYт!=2H`qjv 7HP;!=g渌3&=wGW{/߄UwAZ^ìi5Rys Pug5Gӹ0r706!vđGcfKe7}rȔAmp$16+Kg*߮?]>>%Zܑ>2Ô]"' }yzp8B@vBڙ16}ֵjGkC">&Q)yk#d3%vN :à9OοM&Ws;xJ9=9!mA+|rW{Uԣ#QN*8'Tur]W7r\T0ldYA^paٮ!cҤVhkv 4= {`DIm0sGP^!N' L\\Ц̬3[DmbJ< Jƒk@) dh cn`H®7ѻ m-tNo@N|S .34Ž`Cgi"͈7>>*%&gVNؒdظ7aN2GO[B 82LyWC r*-\IZpkJs@II! 9b0p4Bx[|Sm\%7p{Γ6ýfN6 AFEv~Y* N3 8\.jvi]BwVU[g[1x$G2ǘE ǠJqL$[.4hr 1PP&T0ixJᦲg*8XbU2-j> _;'^;x{|Ss! Kp `+(ʠΞ)$W(;먐s=w/XٗGN8^{xFcF,-ꦮMC 8%iOC8aj ⓗ޲tݍnj{iΣ2oםXk #u+$>Vܩb-]NIvS'_ݓYHquUו}_E#Wu68;ul:$h!Վ;>05YŽw'e^},P"zyI̷*X(.iag({DXj{B^.IEb9DjIFtFÃNe/3STOVm N7y%:9Qe@j (q2Ff}r9lr_ggwDNSshI%e S®(ױ?ꬆE?j~Yso[{jA.ߺ3 -x1zp6!D9r@42{ՎYZmfKy-\B< VJ-'jp{3aHgETr vOk5:8!\G4++}T{xS^q7.jݎ߸BF d\a'RqH8QMByA:CQj6O`X"`ŹeaO` Cf ; R(zW<0_j8N{Y 1vNsHfVL[8$Y'ѿ#[| dxn}dbb\J^c9L}io24Wt@`+B*,8ÈmV /m_ Yy`42pp w^q%'ȭ Kx_ţ(^.)<hln߈޽JO^_>w; 92w)=*sCn:6t& h11Tع @}K-||tV-\34>\ʕ|rys!"  RHW#+/354Wp8=Px8MdP_PBVDqbGqB;JH e蹐"  _*;{ o|io, Jt rO_|]\dAB,Uz(9w6-n W<5B'3%9n#ͮi\?q TxbCgMtTgsݵQBIB@B@$02 \SoW/dfJ\49  ;MqCcxo{R:qxj#Sz#ie,Ze &%nR.D0mGvP@ ` \l5m܄JF[/$ |.:+kͦ8"#g~x ںUx+RI 8RdaAو7r#k75]S4ePrJ/R Jfa\w^=9)+tઍshHrHM,.rl3 ;u瞕hFy$ ;aK-A ?xCЃ5hꅏ77ư3e[ܮ"-l 9G g:!q[xϕh3ܳ2򑒏ic򮚝;Ln3l9- 8LB[aa#vr3JapwdMt!a{kH6_`H~r0tWkrą"' ބ6R4a2 ' 26V7iC?3p]1y8˫2R2/Sh^u +679kż2h]7U4UtsR ggWeagg柔Twf~wcŢl6+fgv 3<{*ZYvYie茼VljՙLּ,URAVbRFUa`)qxC/Y"Y j~>BW3>)ӖSS$. 2:-]*ςBc2I6"[̈́viH܎#Q|f:ZY@'.'Jp v} p+kS" "&jڍaɯʽ& :J B d! w&r%45hΕYPPÇ "6lbrRLgyTώ?XUO)kՍ'Ѓxu{Z>v&}}VؑNđDJU?FYTwBDދɳ[؆-=eAZE(wO]Ifu-YC3d^^:c Z֔m[),2pNwưB|e z㇦䖟7GG9xt7=psliDA4sƌDdHs9yp< YOؔNXI eBgw橩 g2 [%ںy7gkꏸ8 ^>'Wy|Cm'&dcQ]Fhxq vL5{5lgm;zrE(P+pN+W16 2\8ÊO'>/3͐<-ܩ,ēD^2.Y:J!UH楑C^xrvmr.A,~+qTf'k D4&v칿5FWO [=-F# 95mtZb)3Y{ׂmCt81fg@jф1$/bӌcvQ$W ʢk! ۈŨtyrbeuIM 6Q]֒G"._]kuEE0ѡ9,d/#ͯvOpV7_xC`FpXbbB\ O*DS; r9H;I|4m2I!hk2>6+a"cV;P]&沎.oRdҩi,*J˸}K#&hGM^d0iO^yυF6qvu6^lw+nL `zT,|®[4 PL#Wu6фE𔱁 +wd9DVM EfU㏞|R=i"?wfe-u_MId{øQ&(=d) ~{?muu*lvsu6&%gZZ3:,vkWN:j%|AC Y8@o<Z/|.]vc,ɉ*?;h"t7C> l;/s ](OqM?|tW|%m^ڹg'II+62yO-oz)#v3N_mIB ʖTM#cF¤ $kZ?\r33SgtHyꃖ'=EꬆeMCgCd\~cұ!ȽH&g2bs[,V8>ĞZ4WU&WY;,K s :ޕ;/K%>)7V}3a66 А"d$ϝ7u/O{e'\fف(Gv}I؅~=GvP~PQ9i@IO5I&tAj黫:v{OJΠ8@%"e.̽nOݜ 7dLb e32RD{2bHng_ &[fůW<φߟtC@vOY8PP\ 7Z#! ! ([c5w{Y~6I4& ģusԴ37KbHrX0ah\!2c1qj.OqĽ[a7KX: 3S)٦Yukj$^&y#\}7]C v >nU4enOJuQ?$/!egϸ-=sI4aC(G 5 yV}tϾ8#B(0pJZeW̭I dM1$!η*st^;t(~ sK5[10/.\sj&q܌\Zrvv"] Kt[+ݜNIp Sȃ03N#h݅Si,J.#6M_[4)s>HxrRDx䅔Q\ Fglvj4|#i9YG>Vl̤o͇n÷ >6¡u3qXDj]D; R=] o^oP%ShEIf~bmJN/J0]X⯄PqA|% !s؊(sgn4qoE!gJL&mgFs8b77%\9Sb2ics S|S{7V[,b.4I&md%{B'f쥃0II؅qp"aMe- d;kNmyk}Aaw5C[)d((zѩGn=2& SH\\*fa.Kyy|0)~(a3aOkSΜk^e y߻'!A0zHNwϒ[<+8sTJ~稾&&s6kLڠ;߮70[`w~.~ئ4z<1 ,urbRn7=I`4ۭ Zk/`8n9 vڗĚp9ڧR0rg%w }\F<✜Aqt/k;9cXJcƿ/~7w%-ojrikP=w)JX'p*vީM\Iw9-wr9 oKJ® GRD<۰)sҕtj CI^B^֙/ f ״Y?ůƅ[Z`Cޓ ?h+ӟ{OJ 5Ug&~uڅKiFupCcgl;VAaFM~sG8"y:Y[~C| uLzbYtxESڧ?ɇg4X&g?>iMjoSz6ʴ˧12QL+t;8#=)2]AVŦez׎m嫆|WRC3E_-sxAy7=g3 ;='ڰ|XR]Ӛm-:[^RT"ִB!7s+]vAq[Q "P%\=v[ڭ1C]h~dY%יIaM#  `RX,}*$E@GBzfȾlF^ms 'wb g\̹^~2hQ3댌B;]sʆNafs'z`jlx鯯uȪjn%_wb |7pQ0„~دWn*N6yl3z _Зwɑm/XnNv`Z:.`!)fZKۺtfPc6 \{Bt#ɉ;\ LHP%5j-zs(O'x^jރ̡Ȑ$KY]C@s7|r[ '3; AȽe0T0h;f[($ͼ1Z?ЁF^'nXCUg>>g`QL=jTXH/D2$%_hdgФxYP8k 1@aLV \مs81e#>| ;IԸ$DШ}&MȤy_oOͯ߭QQCvj7W+T(+? 4ETR< XTHざ uX'u&3; Gbkvxh4G~Vv;#٣8+X](crhbQ!( 9+~U˛G]އ?4a6D]7PgY)3AæWD+܃S@…k~)c1fF7b.|K#V¶:1aP9}b=җC^u}˺BنL`9 Fҁgc qCe~8'orv. * ߗK37OϾXvO0ʩg*'vV}(fIDATd8KF|9]d">iJ8='Y>;n6"WH9Ok1,'O6 H ǰ,/SE[ 0_4pªm@Wx͜\PL*']~kjv11;\4c֯i0sԫ0荏s;6~917j6GOj$)A[VK+s0wm ̝bzqcE.ά3Ùʉ 3yV:fyg%ΒTm:oZAqYJ v:T B^U~fwu矙Y!>Jdcu'VQs0 Ku͍ #z)1v?/>Qcd^'ʋ iyCyr/"‹ Fl<$^LrRAe+ݧŝܓPQob}g65fdJU5-6~Xq$N#\ā<ݬsF% ^h5mU7k[A8$:`[V`bj.fCO'/>4 :)Pp1YDžfwK2d}1S83ӢCW@{e{ ^IC{d6 /Y஦z51 ]AI؅~Wo:ktJq .<A?(Z5.02W2WtoCy<|r36 Ř!5AL)6cT~xʪiלWP{gw6Re`Vi6B<ި]Ht1ާD Ll'T0FjTZœ1\P_ {ܽi5.;8Д 5Q~y^ph}FO+g \ sˌd@cC)&c>yx6נؒ4r- zdY2O7z_1y.z"% Lb Bmܡ<1A:ZQe P.3pN4v1>y HsAWpzPZ6 CF]쟂%HTX!7s/܂W G91LF$@l>>  A\0=p sPj]#SC m6CM\Sgj l#sTg!܂UQV8.f&\v@ :F aPQtPBg(Ei79KE&v,/0&M $zp[7ֿ:} ~qt(\ FGHQXGQ!BO ~q9Ѩ,C#\!Wx{$=iэ N} ycxS9K/I"vs*z uiO]5@%ߨĶ"8`?|GM …] Y@HL6},3} ;i[A + !^FciQBhڭ]9d :⛊LH JAHlOÂn݀[=@b#X a=# zL9ZÊ"Tnvp`<ҍ qN}fzfX}eD\e"ݝe$d QϐNa¨9&NÄuvkZnDRvoE4.1(B5*";eL'fN;'&;YP0T  ]S/t2HA NPASݩyM)C [A ;Ža 9OC0\=<(& jTՋ\2ůWغ|{Cm)DjGBe-g;8S8IRF7a񙕍涡q= Lf*=_sbQfLN*2P)>ȂC8j=B>=cB&9 nmاTMB ^T"P(ʎǮjTs%O_j"B)FKE&vá>Jk! j?s7$/.搹O,dGITɲ4(+TISw7:3!I'%OHjD$B.]H*1PKITS|hdn#G|}dr[!yup]j1xHW`څH?ޝt;q/{\ۋK̙P Օ]ȠA@P^>yx$u=Cs噣R2=Gӵpճ1b/>p U?FϵR#U7aqS CYd2LWk3r2B#B65mJM&>ΰYvaqQpF&Eb̒d 1!WS4(;Qzi}%ݞy#圞bȫ )KI+)߸ s2B߱ngRf\h=fI=#^ pD `e vQP?/da=iqgAI:sc $/!qoxzɾ*mmO 2`7C$Gfѧ;\ŽaKL>4JTj/0`񕧌} ĭ\=+׾u{^?_ wô80NGRrƌwЖTNG1϶fP[_VL~CLal,B")W}Ɍ,hu+9vt9@@|> j Oۅ٪/55c~0#TW=] U ʋOv17)5^- HI؅S~"[ 㐰ů ]Kf7tfR50)q1 3Va;5Fӣ\>0'.::5g7{m.rvďYv?N$s]zyTmv=:c_k4';.b\JdnF~Rijws* ?v;cP^b:<ϙPX@(Վ& ;Q{£ifC$ю\_|~F`tvK(]6&29Φ4 3'd9>3)+N郇'2lC 3O6چ$e^t4<SZR9rpJUg|ָI+9"ۛT^B 6zT ͤGhJZ?h㪭 ~p0h`ܾn%Nj{w+iJ7fv{\87>?^1oFQ~u.zT "+v]쮝40!@GrOL?D PNGZ;LW?5 7>pU[3e͏ߛ-6r01US ckgn?Mu ^d_ J&U a)9.=yTNڐTCdnh2Vg6h:;%3 }(3!eIɚ)Ψ+aUdY{ v 3p.|qK(lK> }a fLL]RJR$?~?dvX:rINrY~rZsYuy7]r~mnTE n~rn4nˁYg{GPنdN{踆mhM9YTDm\9c~x3 YBC7]=(?X܄5#!텺̐i7~BH*4:BfZP0!fLˎS5]6]kk{P$C\ƨ٦븐s@/}YD ;hۄw8[&i!@U ₆ͅ9 cQ+o;s\/{Q.hًf0"pcFTno%(KPs|ֳF3y[Nb7nTqT:36K} \ݚ̆vT92L,zŽAm=N'2;g?rۏqc6R; !u e<(!^P0BY%Cˎ65 VpXqjSKgL(*rT-d[2@pF:LWå/H {Dz6e\HK=NPm:+eBfm1$fl Z5{4@耶KT`Bq[^ʩ5uMC6^5B╘䙁+!N~譵{mjWŊ^vvpaW7N`aD&9/^9`,G_nuR{G%̄9 bӷc8b>5clΐ…CK~v=~ONBXD8oFF{q!{Wp[_4'~*xy]@Ȝbԓe a=h"ޝrv+0gG/<"$f~lKQb8.oDNSp( [PMÅ6mlU#M \X쯞X9"ncV\v;"u xbb0'slQ r0^8`{=;Pa?.HyG pݮՠ%,f:>G|c;[[ jB\gWﳴ(<pfsvXA7$/&~R""SW#EǑ(oN K*W*DCԒw3AoT8yVw)[[17T_߇`%n\RCB2V(S|# OgDxY?^2$5Arq-'R ?j切u+U Nr0uQ={wui;]ĮqcC| <\*]tbi+ 됑nn〗,A~ȁ,`똣:[MvÄ\֑^D; ƣ` ;6h°PP`Us h@WA-9FI9:T0zzG@"cKvy}@a"R4r={@1LJ$svPypV]106LŅ݀5Wv 翨-קR -*xvqX<';[IUt̆1 3F v[Z @qܶ7B*8&~@s^>|쥧0a(hBLbL{l9Nծx4M9aܞ $I u}^9wf"mhzsf![f6`e1oɐW+{c]G4Ȱ 6cp13XGޱWp22b0Տ&1L R]af\^77 銒{ *`]k!}nv_!A]{{~d Dq| ;}I[A&(tc G8 Y*uH1tP.(B*/nt^ڪk$GFBR#{xHl(]ц3AlݤS+=wmxIsrx48'f <;O|8_8#Il*ɪĴ!JgDkW֓UFs9H2Ьլ%t.4pNaJ$Uqɲ4g0=3:Bzd~|IXMu| 8!hokb0j']O]RQDC!NX.2B辇=Qh6ZV-?XSRvVl2;r 2B;Y0"tDm7.aױi$ 2jd[a'U8CCsy$8( bdK'յU >`'tfSt^/% bטu`Č> BPHu2ŷ"D^Ǧ2A|U%'Ug'r/(~ljRlv[[N挗-+[WN4^Z0ѡ9a{2]+)QO^81CGGsl6ʱY]xl=VwAj2~q_VRTMj8{1v8ڨMX} g_z5F !5A<3HcßNzTORgmL)VPLu穇8c5($2F*2ov3Dfi OӧHb'[;j\nJQ(t>}cI®,4 AsVP+ssgn 먩sǼ+r]o~'_eSgS]a]$nXrgጲ*3d+p*~o~S]aVg2>pQXK :Ք K®7ї@d"BwcR渥aaR`j&ȩ0ii2C&Z q#>}S:εi=Z2ۏ\{'LzC]F `(r\mb_hJ:21 _S95)ޙӎ}tZqTo~jiحgLTx߮@h(Q$`!Hp!U?nA xl;㸇 Va5j\l騽6C^89yRO y` 5ɓVPrZCgf=kr &MwaM6惝v̠r60qqEn)3gJr~['ކK \uo*hW-WT/`œb%  gw9+~-wm29&bɣ'- (\iH R\f*D:?ty1k8Cr9iOM*"5'Yx-^Q|d6;I ¨ K6 |דkScRU W?YAkTo[8tǑcYrj _ۛuNفVd{q,a3v_sn׾8QqS~i"]onDD1NsIEH#5R=wY2ZcNT}PG%fm_:+@5tZCƭV[L㕍6M&KI=>-olAy[w}]p#g-x嘗 v#_b4bo619AWL5 ~e!cftY9`"ZMǚy~XHQ]/44 4;dVJ3È3NES<[j7I8d[$g9.9gƸԂ C sE֊5% i^ g K*W~_woZ}3Nvw%^֊zZƱM]3hCi2rp/;H;xPi9(]ф$i5HBv )Ԃ ZkLh?1 /8*Rl3sKgIԮVlVN2Ue\}ei+mQv|^٣T6]09Ò"o3?_bSKxp^=􍯏q W?u#Ù Ȉ?q/4cJL1G$"ԗ@(G(_ ͑HVjaCxTXe@ILɪ?h5}Lv{-ZD!1|V74&NW(枕nNM/6t:j,z8cKA̎[`d_3'ϟ3̑U[Y#ATsp^R/^~~VJzI"R!@^LE🿵6"5;ysv3WKՐv.,W ͚li׷j6M9m\ZQpq%QȌ[~RߌfO5Py=ñ5ŵN9#K*wՠƦ2 .(Aom@hpP傫=v l}Z@@v@UjSB H 0@ӄRAYuN%xP%#Ϸ=[(fRfꟋ7G?d͠= nPV\œ .7ԗ.މ_=9"v)*Zq 2ƉdSN3{|jƐiN3|#Z0_~)YyL΋ɠ~WuP`yF`.! ;qxI%N %d)(Tlh5]BĶ B9eEV;e__fo"5'42:5g\7 yC:Cih C@4eraHЃ`7-~wwiQBhڭ]yd蹉cvbfcs5߸oǺi;0q`Zq@ GIEf  Нyy DP0kOl6PmƩ%.[Kn=soZf]Q0.x`476/kš'P5zvAK)_77=}|Z>Ν9w?sːi1uPScF7  i 5k\"{Lxg0 'm 3/zs܏:eg?qtљiOqkK`&B$B Ԝ@P=kbڱ+q[`Č' Z;Oț);T~eq7LQxqvk^1h*M2\'H,ʴϥ倶fYUNԛ:%r<>oWPGvԞ@ Oc]t?FsrB٪C!P?^JeC$BԈ@x7h))up*rB⒣&: *"^P4_uD0.+mmu{QH2+\&OaY}Ak6ryVj|BK[Y/AGA"UITGB :\Z [il,;#kg1,ˆa7tv,j^kvesS9svH^.kk>^>`܇xͧ}[3NPW|!z NIDbW72%a^$†ӟi$:TSG(s8oп\3bѪu;kN嘋u=aq :^SzF&2RJٻ?vy OfX0)bЄ;./r[>?>GE_x~am}iI]+$ojFLepn5֝Tp4 [n-p]qJ Ɖ`9QJiӇmO 5+vBǺQ 9H 83qieuV# ?Eb$ GJ1*L 4;C73 SqPlcFVXfdϠxT.nr]%\9y1]5v';}Zg+ivۙ=x~VpTq|}f2_4ZXLugut9wr{]Y9 +HH5ـ/R)07&~麦s 2e i1+>wAH *W|Hy# ^_i( %ƇIS,adκ6@ $[q,]Ȓqs9w׹s͐IuP*;X6!p`b?)?{t4{?li9a.0]V'UvrҸ\~``{YLrFE9o ST^ֱ_փTU}ު[l8U;Is@Rc。BA輏}SO\A?OB0>5F !B31H#nQcÄu2]8;˃d^0弡vN3PΗqj<{/S/pRz h)bcYWmmzC;g(G/wj< FHPUt; N͘g2LLԃb6jS&u;Ht! [i@J!ARF"?CqD"%'Ȗ=~XVvk^XS[>!~]x>13tF_͘`ݞSS7>Vl ?qs}]ջ͚Fæ₄$,ȣA068yؖ;4rE@-e7 p{[U֙Zw'%O3fanbRԂ@#Jy~G, (\iHBNUyT EaV\ R2㨔sAI/$(T sa`y܉%i3cY/!3﬌?s'4c: ><~ʝ+撜T?A˫#)H[4lM#f{g5iaöp&d2B@vZFB@ N="<,.Nl聶gY/帘>p|JalĻ^=Aw5v@O @BFeq2w 7DeW0w%_GkL,-w=&Z205dm{A3o|K.e* u}I؅Q= " L`RR\( /ORhtEG)3)v#m/Tݦ<~zȵ poY  \`lvps&fÙjcڸ :[}V:89mqvR1/Wl+oztf|vKw].*!/'QP)d[ ϠӧB.9W~'4{bV>XV9N!{ʪcNTtf=p^S/51moK ~74-g[ys-C[zl~iceg`d?_wo] `Q:tk7#ǰwgqy:@uD:HC$BԊ@PqJǷ :S0ƍwKfmm0q@p5^~G' `P*uF Цǁ#N-7S; Ȧrܘ<1}l%gUŅYߵaĩ#q;Nӓ\gv}j?{ֹgrQ9?[Sy?U3Fl6g@Y)$a'-l@eST~ =6Dד1NnMCOʳ(]|,R1uTB ] P&f=γԧ[㤃3qveh Hٙ3ؖk6L<8?1cm?iم.zv|\Դ&V2cF߱ng͂hw1TxG.}I!l_ WpXH"M2_*f$afc>έymv@qirGn3r0gjݹ<%n~ wtxG4id2;:\xcHi| bf}#arrNOPɝsH@H;`NCB\ ZgfZs Ve%WV3a {= 8ڽt`Z asMVSb11p62jůuB1=쥞;WiZKTZP)%€7MN9\n! B& 8O;W&OM돣ACA{cz )QO:ܟ=6m[l7OW8DQ'?Ge;Iƫw(/]@bVJFq9q\wip8D\j.' 4Iٳ3RՐ=hlh5[Nͮpu] Z}Lv/y/|/-_۴W7dXӺȈ.3& )LWg}Tݎlӈ C>$ʅI؅bXG@S3ZD[y`aԡ"Rsys2G}*.-']ubpS9h xZ{^Ä)f,E5MW-x-Jؽ+qjwӯ py/NFt5~SR]՗]ؠm2|\p+!e p|u?C\Ϧ2]>*1DpStQW ֻۼ& 4T4~q<7OICGq]S/v[T)1a,esެ3fV߮vܢSsWޭɣ%Qu =(M$aכK}f~~58=sm֔m[)ʗd ϽΓhB@vѴX,|V,K4h yQ[Fhw!X^u>cpشKC~9f=AwIȤqC@41OҞ^q7_]vZ:7n$ $m'NoUa~.z($?z{IH9 V `]fo>70ml)`$ = =R i FGz13i @ pp$zú[PAܺ "I &evv V:+7[B NwX;PC& CqAA 6>M CY>H.hJmS(J %d)xl%:dfC'c$JͅH2 A5O6q!d)z lܻt]5=++S0K (<(sxcQ!e%a7UU8`qD2݀r"'+frw* ^v[D6Ӊc1e> oD(^fPu˶=|:>sϚ9W Yhrmrnv0/5)I؉L/ Mn1б|r(GA0ԩF+&tE GdZIV6K!^AӟrO,6rTxkV C*Ť78sӆl=&[WYIT!7Q%1m`"AШ|5C-S@nL%?(hPBI^ݖ|5X^ݞTP|`(;TQ|\)>ES~I?.JEY#5<9L =f ;$zw˴b2;C{5Ѫk!4B;$G `Pzz9s ';m0fL?IE|0uNWU&ɧ /?yʭ/VXG+5.!\4)`n}SRRx~Э46p1twg#VfJyaW)¬oHiՇ9F DvXVN/W#9N,dA!.W(sVe;=b4Ti1|UL;I!c4]$a !PVGӧG/3yy;*W&k>N0vөPﶣPӇ(+xs\3eNp" s;y{:4`Mͻլ%TpmK.K [}ֆ0ر{_;F+Oѧ LPFvaŒ?Hwg+M NzF AѶEdSR* ߻3# ^1ejoH;H44]n*X%$:jwRCE@J. ؤJ.YaEVRwlt[N6Y% ^j]4ٲ󠏵˧?>^Y-x zp6O! ƽ~oHlasWNYX?PB(4 ㈸W$8۔4#d2t ڭg}%F$]@`\(A58n~cxe'phX!:]ҽ/7j9Fkt.wcfYc%v"MUU&.Wfr@_ bkz3ϡ:!k:QhDs\U\rSX5>PHv@ObRЃ bhOO,)jCoؿߗ]@J:!Q[ atfSpﶗ2H23xK&&U5V$07n xF;z{O/])cjCvBRjO#v6Į&@vO],|{ j<f_ Y=1^]t2u 7d\Nݱu3-ӽ+xQ'5Z/Εt8l^^WKڻ z_ 2#YOHw'F JnlX61}1lT.ߕ6IT3 ltSdnמ'%20*,uD޽O貐 1)DžS\c 5{bl:~>gDǰ- 摪]w Nq{+ S ?\6){18M?bPe [A̦YGOT`#[K'=hbp@o̔gJJ2>%d?4,#6yif7hp]OZ4WQD(^alz/fGV{iws>VLGn;pޓ_fgseӓK?xa_Z{W,^Ih 䂜"A]b\5{dB.fpSN(-B*/贫r^: 5Mcpg݇ޯ❋]aÎV=nOQ#J.wVE?sƦ}&8 *1*\%fSiTL #BOը%Rsy3 :Ǎu/t~XKG~ Ncrח5 2k73TV8o*1]%),7YJwzFB uٌ"_4%=;ǖN@D&.6hwwQI˭@ achƼ@S/ݴTuNvrs \P](̊K#p-fa(Yj@&4S|0_jOM*"շʰ+"5 ؞{|Ҥ#uTӿ7-]vhrV?$,\Fҍs?,׶iq8xnQ㘡ifyԦ{.hWԱIyw{_=>_qvÝoTmۭ޾! Zκ#yhJø){o<&w=lț]![3qqrea2h_@60%ѴeU@(|q1Me}TbF͟t#bn۳Pn&'^_CdL r+Q0 k>䨀48Ʋ0GpjzxN803G&eC=}a'ϸ~Nv[aw]QXdECyq9`9ɓBФBQ@O;PVTjk')5qK X 8P8]`%l5e82=3'F_HWHM0ʦx[@s5lmb"_G25^!hῄ0c!kY(SԕҫmUu 5f|SF8ho޴G$~NslNmӼ#\QSSgU6| p^ SFg8oƢ4h[i9{iMW'nRF NK=kl?ȴqqs-+ ;HI$|  lpi_c Tv ;+bbX[kwqgx3~ *4hAA2Ov%ZAayy5A'?pϽ/@;;G((>kvN3f08.NJ)R'06j# 5{@v򪲋s@d_O9piv,Ĵ<6~ٳ?>jr/6 ߩPK.@jN-o9;Ʌ89 0PzRR mn3T%;G;&k y yF3pN?S:zdlA :b/s >̍l;/^5 !@FKtlW'Z{PZNNWAL0ng?>8qXJi갚Wlj+V?!ۛ55uWyӁ?yǬ TLB hψP||xns$Mj\/yho)8(ˋ1Y \yvm3ي޻s{ DHBWl1L Z r60mnZ-/sHUSM8PЍL_0G}jT<( 7eqh/~Q{5362Rg ƻ΀ „ q=șjʢNS&8xݮSu*FE.gd'&!ЋFIPf+v ܘͰ)k#j$r> l岢+~wg\fq"Y#+ ~c#6F`U`z1|hFefo'^%aj5&7c당_&n8Fxbg^rsIX$_*;әUU'ܳ%~$ @mJYROvq|*NۦuG׻`Y@7+Fń}K?S!`7H|/ H,v;FDγ/0,N\m>kxGÑƫ?z$ kdbAǕV>} 70V3@h@$ϸ`]X7CbT%x mblښ[/JWs6+Y~ܭ%3>\yכZ|9?~pp=+#ff͜]FՁ8tRycETc'~y?l8U!o_yy|3"T?" ޔ lv8k /NM7ɾu/Ywz: "l8Y 3z7c6yi#QwC;q;z6-B=WVێ|^2kƓgmKi㇇9TmnјrRԸc4ٲV 8\XSʵV_|.z K3,<+S{v.='w+y &'~Y^  Oo]o!/' N!2x=3;~x6X8֦g49}iMǥV˽]ŝD^=Y8p@;pϪڧ9y!+˓?3US1x,@fsׅT'=`Q}ɭ75,_ñx+wZ&h$9A~?5eT?Q%?+.U%3F֊V͟0ߺk>>r,ʒG."~UWvBVj!gD>blf+_N\H; y~?F^8ofѠoj卜w2XiYW.N_dwV!Ob>G = e<ppWiBc[s/YOMvWuMUw q'}EwD'eT.+VUg7Nw*e'z<7+u|pPh dqD|;餭` 6tAt->yCm"ffYFjO"˿k<(3Pz ל56WuMΔ58"2Z`~jc|a WЂqB:Me : @[;,6+ ͑3Ʀuo)l ƠG&(}ogziQBhڭ]9d{zwul.;ጻKv1ËJ)v83S"fFqd9ڡ5(Ӽc@G1sgNJP r8C+!O6zHľx$#+}ͺ GmV֝A NnFaǔ "r}k!A,F'{ ţB5?!](M,+uˑK{hc/7gm^J.K$@ϫ#pN:It0UmNMW&)Ճ nnx3%[{BĘڰyq2t8LKZ=W(Tgb|{3V׺]w)sdPw VKo ,Nfa_/0 ҅& ^Bp׿N.?l&V|~UK/.91.^^{ϗw_ YNv"c~ZI9lŸgyT`;E <'$x]&8N-uoR4 euw%MUYitM[ ]JA:,"ApeDTqegPtPqgFdD6"[)-m ii4K9%/yI{I"&;?ϥd]R 8+CH|[PV{O-+ #ޥ<+9`eˇg;lW.M\+l4 D>:et"C תidAVd*[95I5W?adj,t _钡u$V?:|;pBke9h{bflr+'gq@! 7x:Zϐ!.<7 Ѣ_X=/sS:5acw5k&tTC8 mYr X=qIȌmMwUTh~R 250-Sb@ze^ 骾e2~Ϝz#mwg7EmJ̞vvFv|cI.0 6i%l=aoww9M ;o <E@!/[VM||!YriBʠ/2Š#F|z 2eO<^Oqh[6sLE fY\bNa)]Xq:v" 7EL1XeGk4 Ej AN($0UrƧ$nԫ5~x,{ 5{be֘7dd+qsi 2$nܣˁH!!y0"bigZPTaѶU#Sj\!A~k[Ï}|Wfg^Ƀ`Tr.ziF-NLLo_8 7rk>+!N^jUFG̺+1REs[i~يqGF23RN^ִ-<|nL`p9R/1 :t0h@qhv 0L9_ߋ'd)^a.qv"Z+XTL+gJ!jk(zkyRkǐ鍆Ib!_kF3ƪGiQDHSP*ɯW:u)%.9 jce>o3ٿ%O]j!3CC\v]UW\:7eoba[q[_X|rqI 8bΔ8|W sr"wr 瑃ʑBMW>Fa=%r]@ SćF.Uo/_C gNDۣTTefbljE&86U,p~Ƀ7emr#B0ctE2aqe\KbXCbW+=Iev_-(фɇ{ ]c' PA9ۄ]bJ^퐙Tvda=uG&ݨd? dvYeY3 +wmY{NH/\ Ds /*#8 ]ߖHٱycIR ~w8V}*?lfP䱑`v2K_?m7ٓs[ PjuK%PK3:kikU|l^fg?zռݍ *Ngt*3l@x^LO!3}N,X!ͽ_d^kafY+^@R8X~biSa=6v,̭±C` F ѠpPL k]:77r _~\a]fvbRzYK#gEt*6."o˝ɜZEޑS!'wdIR([n7P.=ƍܱr dzxȍ[ukN/->th;bʘe8zFc2:kCDUVg+Fvwα=]7v}#0 RiSظ_T+xyYxفb1:>] <SWvt|̘Δ^_RH̰_e%RB$+2e=MFlM| HATUMDKRbRKvaΓMƟHZ#=UsC1؛LWj?'2TԡR7g5}>( $0.,}tf7 0A0`[H]m-FB2*g\h~`6>3T4jICCASƄ%) rđℵWZDOY/&.\ڞ_hr8#9˽S*<:oϯxΘ8_2kjӼvO.{7<0c'OX]?ZǶ0:BP,baG@n0GDӠȬMM9P\mvT:?^(T6.(,EȬ.|ug~ƒqy 2†iZVXb*VP(rR\\q(L:N3@$Ҟg#Y:o\wYwv+s>zx%[w3&|ϱ+[羰tan+c0$T502MJ6 +r74K8C-F䠂O_J}7)Xn6I”2@փzk5cfBچ؀Ad\ކN+75*4bXc։Qz&WP lĴ>؝y)+lhVhy4Jp̋ޥ2s:l19!ުaͮ?47F tD-Ƕ#j)˱QzH YGv5zϙ͟g Ae~Ya1i8EٹSv|^a#4`b6Snn&؀$ JR<vmuc{0(NWW37>փAQZ$;\_2ÆP[}^A=ZmK Ғ,ؓ w7Oba j F FTl޺G"ǣ3;lcH GO\^;7%#tk[=krjI ϘA,"?pq؉GD<8SRՅ1{m n\`Pw9re$=؞O‰ˍִR m~QQԂS& Aϔv>]) # hT *1߷6=XKV®?}cznӝe~q'K@_][<[B`UC&y!Y6,{|S/^#K1S#ʔmq_8unsQުRF.k~~q&~utԘ&өK- >;L1×ɗ^Bu1F"4@t5+$Ig$rG(u:F+,J%dJKŻ1TGܪ;.v7>= nW#V.ez8\8Y#b=L >Oر3tyzF?SMHX6H$~[tq+;S?u]ٞP7:z1V﯊V[PzWu!_!0xtÚ@aa.0^@T$mD  4icg=?HO q-L-zKrjB|JɞCӀc[ߛPރv޳x&+"L"pMՐ'33kHLrBx踴pew?#{Մ}dʔ8IC#рGOᕦƜ#RcVԮOW#WoFESidZۿ>8 X ;ȕ^nS36gM*J/)ff?}r|W> B7{ _l,h[L:3_LHvG|ܩÒ.U4ɯնwTIgsZ#t7x+; uyyyrAk\_-iR ~4]s3rˡaaۃ'KC``*/*SNI2#=I&:)y'ϿgĨ݇/}of}AcwɊ] :&6f糒ߚ7? h\_UUmއmYu=oX;G!e e JIiCę#oʞRO <lhl_$kUwnq^?DM̐/uUG˘YA@HN (nfwFKZ|TCG)ս3U6)pD|B`DCc+d ƒ#>uhXУM}P,kOݝ)l1?~6~^ꝠVs aY =v7ăb! ԭR'&Þ>aڻE]Cʠ/ ^-ǡU!6Ά";l_3c隽 !YMaeO]k]?\[)mԢ`y` tS0:DqUlv A'3.ec' 6OJI)nZ1(TL7]P(0[ha hn7G x'M~A:ShU3#V| 8Ng!6mߗ,\ߝ@Cfk&}Kd}!,׽q5÷FH).c8 y?#!dٱLPwdgƣ+2c 5D-/c(c"a|~Wye7xxVFKRU3 (+S>ŌȆoeôI{ga @MebgL `d?9Ú؀sd  C ˝f~9XynSf?Dl;-fʷ2aZvHͣ S3ĉߍ}: ^Wx^@Yzƈϛ)ߓ H2f 쏳'WeZ0F#/nvIENDB`$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$IfK$L$q!vh#v2#v:V l t06525ytxX$IfK$L$q!vh#v2#v:V l t06525ytxX$IfK$L$q!vh#v2#v:V l t06525ytxX$IfK$L$q!vh#v2#v:V l t06525ytxX$IfK$L$q!vh#v2#v:V l t06525ytxX$IfK$L$q!vh#v2#v:V l t06525ytxX$IfK$L$q!vh#v2#v:V l t06525ytxX$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v :V l t 6@f065 ytqp$$If!vh#v#v:V l `` t[[0[[[[M,655ap[[ytV,$$If!vh#v#v:V l t0[[[[M,655/ [/ [/ [/  [apytV,$$If!vh#v#v:V l t0[[[[M,655apytV,$$If!vh#v#v:V l t0[[[[M,655/ [/ [/ [/  [apytV,$$If!vh#v#v:V l t0[[[[M,655apytV,$$If!vh#v#v:V l t0[[[[M,655/ [/ [/ [/  [apytV,$$If!vh#v#v:V l t0[[[[M,655apytV,$$If!vh#v#v:V l4 t0[[[[M,6+55/ [/ [/ [/  [apytV,$$If!vh#v#v:V l4 t0[[[[M,6+55apytV,$$If!vh#v#v:V l4 t0[[[[M,6+55/ [/ [/ [/  [apytV,$$If!vh#v#v:V l4 t0[[[[M,6+55apytV,$$If!vh#v#v:V l4 t0[[[[M,6+55/ [/ [/ [/  [apytV,K$$Ifh!vh#vO#vn#v1#v#v#v:V l `````` t<[[[[[[0[[[[$65O5n51555ahp<[[[[[[ytV,kd$$IflֈK q#On1 `````` t<[[[[[[0[[[[$644 lahp<[[[[[[ytV,5$$Ifh!vh#vO#vn#v1#v#v#v:V l t0[[[[$65O5n51555/ [/  [/ [/ [ahp<ytV,$$Ifh!vh#vO#vn#v1#v#v#v:V l t0[[[[$65O5n51555ahp<ytV,5$$Ifh!vh#vO#vn#v1#v#v#v:V l t0[[[[$65O5n51555/ [/  [/ [/ [ahp<ytV,$$Ifh!vh#vO#vn#v1#v#v#v:V l t0[[[[$65O5n51555ahp<ytV,5$$Ifh!vh#vO#vn#v1#v#v#v:V l t0[[[[$65O5n51555/ [/  [/ [/ [ahp<ytV,$$Ifh!vh#vO#vn#v1#v#v#v:V l t0[[[[$65O5n51555ahp<ytV,5$$Ifh!vh#vO#vn#v1#v#v#v:V l t0[[[[$65O5n51555/ [/  [/ [/ [ahp<ytV,n 666666666vvvvvvvvv666666>6666666666666666666666666666666666666666666666666hH66666666666666666666666666666666666666666666666666666666666666666p62 0@P`p2( 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p8XV~$OJPJQJ^J_HmH nH sH tH @`@ NormalCJ_HaJmH sH tH DA D Default Paragraph FontRi@R 0 Table Normal4 l4a (k ( 0No List V^@V -q0 Normal (Web)dd[$\$OJPJQJ^JtH *W`* -q`Strong5\BB -qapple-converted-space@@"@ -q List Paragraph ^m$@3 ELight List - Accent 5:V0[[[[j.@[[[[j.[[[[j.[[[[j [44(fdfd=CJaJ5\5\5\5B*\ph6U`A6 w0 Hyperlink >*B*phcRoQR w0Unresolved MentionB*ph`^\q FV`aF w0FollowedHyperlink >*B*phOrH@rH qp0 Balloon TextCJOJQJ^JaJNoN qp0Balloon Text CharCJOJQJ^JaJ44 /0Header  B#.. /0 Header Char4 @4 /0Footer  B#.. /0 Footer CharPK![Content_Types].xmlN0EH-J@%ǎǢ|ș$زULTB l,3;rØJB+$G]7O٭V$ !)O^rC$y@/yH*񄴽)޵߻UDb`}"qۋJחX^)I`nEp)liV[]1M<OP6r=zgbIguSebORD۫qu gZo~ٺlAplxpT0+[}`jzAV2Fi@qv֬5\|ʜ̭NleXdsjcs7f W+Ն7`g ȘJj|h(KD- dXiJ؇(x$( :;˹! I_TS 1?E??ZBΪmU/?~xY'y5g&΋/ɋ>GMGeD3Vq%'#q$8K)fw9:ĵ x}rxwr:\TZaG*y8IjbRc|XŻǿI u3KGnD1NIBs RuK>V.EL+M2#'fi ~V vl{u8zH *:(W☕ ~JTe\O*tHGHY}KNP*ݾ˦TѼ9/#A7qZ$*c?qUnwN%Oi4 =3N)cbJ uV4(Tn 7_?m-ٛ{UBwznʜ"Z xJZp; {/<P;,)''KQk5qpN8KGbe Sd̛\17 pa>SR! 3K4'+rzQ TTIIvt]Kc⫲K#v5+|D~O@%\w_nN[L9KqgVhn R!y+Un;*&/HrT >>\ t=.Tġ S; Z~!P9giCڧ!# B,;X=ۻ,I2UWV9$lk=Aj;{AP79|s*Y;̠[MCۿhf]o{oY=1kyVV5E8Vk+֜\80X4D)!!?*|fv u"xA@T_q64)kڬuV7 t '%;i9s9x,ڎ-45xd8?ǘd/Y|t &LILJ`& -Gt/PK! ѐ'theme/theme/_rels/themeManager.xml.relsM 0wooӺ&݈Э5 6?$Q ,.aic21h:qm@RN;d`o7gK(M&$R(.1r'JЊT8V"AȻHu}|$b{P8g/]QAsم(#L[PK-![Content_Types].xmlPK-!֧6 0_rels/.relsPK-!kytheme/theme/themeManager.xmlPK-!0C)theme/theme/theme1.xmlPK-! ѐ' theme/theme/_rels/themeManager.xml.relsPK] |;|; ooork $ U#&'+^05==@jB|C"19;=>@K[`cdghjlnpqs & K k > I 5 T W n *'*iF`a#$VW#&)-4N=JA_C|C#$%&'()*+,-./02345678:<?ABCDEFGHIJLMNOPQRSTUVWXYZ\]^_abefikmort7Q7x7z77:8<88H9J999999|;XXXXX/XR$˜v.= 1 4b$,zwEɍ?U # @r  (    R[1?"Text Box 2c"@?PK!8[Content_Types].xmlAN0EH%N@%邴K@`dOdlyLhoDX3'AL:*/@X*eRp208J妾)G,R}Q)=HiҺ0BL):T뢸WQDY;d]6O&8* VCLj"󃒝 yJ.;[wIC_ :{IOA !>Ø4 p;fɑ3׶Vc.ӵn(&poPK!8! _rels/.relsj0 }qN/k؊c[F232zQLZ%R6zPT]( LJ[ۑ̱j,Z˫fLV:*f"N.]m@= 7LuP[i?T;GI4Ew=}3b9`5YCƵkρؖ9#ۄo~e?zrPK!:[drs/e2oDoc.xmlTn0?789H(.@SD$c )q[Q,oh4HښϏfI+Qǻ眅V|+Zw9JأngbC51(襁pNZ2 Dh< ntQfŀq ȗm6tͩOu:%T++ R= "'2Jx #UBnzp2B n?`wTC9`G9Fv#+x*zpGRkn5{?xۃ8*o" '$JO3zfG`N4mԤR)ł ǧ"%?I4, 5}}^\RZ5wJ|ن[jpLC]vބijfқ$~.R-Piw25?oR' >&DPz{mS[Ib(2HaIfK\y66ojxISlIZ|9Yt Ӥ&6LYwѪk%D[mlZ{z,PK!ܐJZ drs/downrev.xmlLN0DHHZ;1T%ͦ8M(vqOp\̛|;ێ][GR3T9Rp,|PU ܌mL͵ 5!3Єg1V Vx5׃bx*Ċ[RlhToS]"rݤOY">?ͻ `]?Cn$YHY%n"][*9?PK-!8[Content_Types].xmlPK-!8! /_rels/.relsPK-!:[.drs/e2oDoc.xmlPK-!ܐJZ drs/downrev.xmlPK   rA? "CMYK BLUEPicture 1CMYK BLUE3"?  >~A "Diagram 9 8 8 #L%#L%L!'L0*~**3;:O;!?b3@3@/BK(/BK(3@ZB3@TH?S1`T-`T~*FJ0*J!'(L% 2L%(C#B8 3"`?B S  ? G |;)"l@<#<$24@.(Stmo9999::::::k:l:z;};$ E *12]@E4!K!!!b*j*999::::::k:l:z;};333333333333 7799:i:};-}t`GC`k|"I4* 9, NQ.%PzU`<`D+4d`7AWd7ZʿI HH1k!4il&?$bX(ng%,0* 'L)@J>0 f.fXS0Z4O_]9vK$o@>nA\SaFE0e}zlG\lHf"[-K&*g^jOҏX\`DQvU^`HgT4l$TS\vڨ4cbc-0qjr kFo@hc rXs|oa@tZ>t ePguJw`0yTHDm|DY^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`.^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`.^`CJOJQJo(^`5>*OJQJ^Jo(.pp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`.^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`o(.^`.pL^p`L.@ ^@ `.^`.L^`L.^`.^`.PL^P`L.^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`.^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`.^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`. ^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`.h^`OJQJo(hHh^`OJQJ^Jo(hHohp^p`OJQJo(hHh@ ^@ `OJQJo(hHh^`OJQJ^Jo(hHoh^`OJQJo(hHh^`OJQJo(hHh^`OJQJ^Jo(hHohP^P`OJQJo(hH^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo( ^`OJQJo(^`OJQJ^Jo(o p^p`OJQJo( @ ^@ `OJQJo(^`OJQJ^Jo(o ^`OJQJo( ^`OJQJo(^`OJQJ^Jo(o P^P`OJQJo(^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`.^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo( ^`OJQJo("  ^`OJQJo("  pp^p`OJQJo("  @ @ ^@ `OJQJo("  ^`OJQJo("  ^`OJQJo("  ^`OJQJo("  ^`OJQJo("  PP^P`OJQJo(" ^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`.^`.pp^p`.@ @ ^@ `.^`.^`.^`.^`.PP^P`.^`CJOJQJo(^`CJOJQJo(opp^p`CJOJQJo(@ @ ^@ `CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(^`CJOJQJo(PP^P`CJOJQJo(^`.^`.pp^p`.