ࡱ> IL89:;<=>?@ABCDEFGH 0 bjbj[[ 99دR XX,',','@'@'@'8x'<*@'8/L/"///vvv%''''''$P dK,'\vKXX//P`(XB /(,'/%%& #e/7N2ʊjAd~ 4 ee ,')vvT@DvvvKK"vvv vvvvvvvvv :  STANDARD OPERATING PROCEDURE:INTERPRETING AND TRANSLATION SERVICESSOP No:TW11-023 SOP 1VERSION NO:3APPROVING COMMITTEE:Corporate QECDATE THIS VERSION APPROVED:April 2017RATIFYING COMMITTEE:PARCDATE THIS VERSION RATIFIED:May 2017Author(s) (Job title)INCLUSION AND DIVERSITY SERVICE LEADDivision/DirectorateCORPORATETrust wide SOP (Yes/No)YESLinks to other Policies, SOPs, Strategies etc:TW11/023 INTERPRETING AND TRANSLATION POLICY TW13-046 OVERSEAS VISITORS POLICY & SOP Date(s) previous version(s) approved (if known):Version: 2Date: 2013DATE OF NEXT REVIEW:May 2020Manager Responsible for Review:Trust Board Secretary Your hospitals, your health, our priority CONTENTS:  Page No.1.Introduction22.Details of Interpreting Organisations23. Guidelines for using Interpreters2 4. Procedure for Using Telephone Interpreters 4 5.Criteria for Booking Face to Face Interpreters76. Procedure for Booking Face-to-Face Interpreters 87.Procedure for Out of Hours / Emergency 108.Consent119.Procedure for Accessing Translation Services 1110.Guidance Documents1311Human Rights Act1312Accessibility Statement13 APPENDICES GUIDANCE DOCUMENTS:  Page No.1.Frequently Asked Questions142.Checklist and Guidelines for working with Interpreters213.What to do when talking to a person with a hearing impairment234.What to do when talking to a person who is visually impaired255.What to do when talking to a person with a speech impairment / learning difficulty286.What to do when talking to a person who is Deafblind297.What to do when talking to a person whose first language is not English.30  1. INTRODUCTION The Trust has access to the following Interpretation and translation services: 1.1.1 Access to Telephone Interpreters. 1.1.2 Access to Face to Face Interpreters (other languages) Must meet Trust Criteria. 1.1.3 Access to Face to Face Interpreters (British Sign Language). 1.1.4 Written Translation of correspondence / patient information (in other languages). 1.1.5 Written Translation of correspondence / patient information into other formats (audio, large, print and braille) 1.2 All Trust Clinical, Nursing and Admin Staff on all Wards and Departments should be aware of how to access interpreter and translation services. 1.3 Interpreter and Translation Service Guidance Handbooks are available on all wards and departments and can be accessed via the Interpreter Services Web Pages on the Intranet. 1.4 This Standard Operating Procedure should be read in conjunction with the Trusts Interpreting and Translation Policy (TW11/023). This document sets out the process for booking telephone and face-to-face interpreters and how to translate correspondence / patient information into other formats. 2. DETAILS OF INTERPRETING ORGANISATIONS 2.1 Language Line: The Trust currently has a service level agreement with Language Line which is a telephone interpreting service. When a patient requires a telephone interpreter, Language Line should be used. 2.2 Language Empire: The Trust currently has a service level agreement with Language Empire which is a face-to-face interpreting service, providing interpretation for other languages and British Sign Language. Sign language interpretersinterpret from one language to another. In the UK this is usually from British Sign Language (BSL) to spoken or written English, or spoken or written English to BSL. 2.3 Face to face interpreters will only be provided if requests meet the Trust Criteria for booking face-to-face interpreters/the practitioner can provide evidence for specific clinical reasons/or sign language interpretation is required. 3. GUIDELINES FOR USING INTERPRETERS 3.1 When is an interpreter required? As a Healthcare provider it is our responsibility to provide appropriate interpreter services. An interpreter will be required in the following situations: If the patient does not speak English. If the patient speaks English as a second language but there may be barriers to understanding. The patient may be able to speak English but whilst under distress, their understanding becomes impaired. The patient has a sensory impairment (hearing or visual) and requires specialist support. The patient has a learning difficulty / impairment and requires specialist support. 3.2 The Trusts required method of accessing an interpreter is via the telephone and should always be the first option for any staff member requiring an interpreter. No special equipment is required in most situations, only a telephone. Mobile and cordless devices can be used with the speaker facility turned on and the volume raised so all parties can hear one another. If however, a health care professional makes a clinical decision that telephone interpreting is not adequate for specific clinical reasons, then face to face interpreting can be arranged. Divisional authorisation and evidence of clinical need must be obtained. 3.3 Identifying the need for an interpreter A key element in providing appropriate services is ensuring that the health care staff and the service user can effectively communicate throughout the individuals journey of care. An individuals communication needs and preferences should be recorded at the onset or first point of their care. Where requirements change, these will need to be updated so that other staff involved with the individual, have up-to-date information. Bilingual staff should only be used to help communicate basic information about care or personal history, signposting and basic information such as visiting times etc. Staff must not be used to interpret clinical information, medical terminology or to facilitate decision making in relation to care. An interpreter must be used where effective communication is critical to patient care outcomes, such as: Admission/Initial Assessment History taking and care planning Consent for treatment and research High risk/life threatening situations Pre-operative procedures including patient identification Explanation of medications and treatments 3.5 If the need for language support has not been identified at the time of referral, or the patient is admitted as an emergency the person delivering the care is responsible for identifying the need for support. This should be recorded in the patients records and that person is responsible for ensuring that language services are provided. It is not always easy to determine how much someone can understand this applies to the patient/family/carer. Some tips to support your initial communication with persons whose first language is not English: Speak clearly and in plain English. Give time for responses (30 seconds is not unusual). 3.6.3 If you do not receive a response this may indicate that the question has not been understood and you may: Repeat the question, ask the person to repeat the question back to you. 3.6.4 If the person cannot respond or repeat the question an interpreters assistance may be required. 3.7 The following questions support you in determining the language competency of persons who speak English as their second language: Do you need an interpreter? Even if the answer is no, continue to assess the need for an interpreter by asking questions such as: Can you tell me where you were born? How long ago did you move to /this community? Are you satisfied that we can go ahead in English or do you think we need an interpreter? Even if the patient/carer answers all the questions there is no guarantee that their level of English is/will be sufficient. In stressful situations such as illness a persons command of English may decrease. It is crucial that the patient has full understanding and there are no misinterpretations by patients or staff In order to ensure the communication needs of the patient are met the following should be clarified where possible before booking an Interpreter: Language/Dialect/Country of Origin/Gender. 3.8 Role of the Interpreter: The role of the interpreter is to facilitate communication between two individuals, typically a service provider or freelance interpreter, and a patient or carer with a concern, enquiry, request, or an out-patient visit or consent to treatment/treatment as an inpatient on a ward.Trained interpreters are bound to maintain confidentiality and adhere to Code of Ethics for Interpreters/Translators. The interpreters role should be respected and does not include: Giving their own opinion; Chaperoning; Advocating for the patient; Undertaking other tasks such as translation; Lifting patients. 3.9 The interpreter does not analyse information, or decide what information should be given or not conveyed. Neither should the interpreter be used as a form of direct support to the patient or provide any other service, e.g. counselling. The interpreter is there to repeat what the healthcare staff and the patient/carer say to each other in a language that they can all understand. 3.10 See Appendix 2 for further information about interpreter practice. 4. PROCEDURE FOR USING TELEPHONE INTERPRETERS 4.1 Where there is a need for communication support, telephone interpretation should be considered the first option for service users. No special equipment is required in most situations, only a telephone. Mobile and cordless devices should be used, with the speaker facility turned on and the volume raised so that all parties can hear one another. Face to face interpreters will only be authorised if requests meet the Trust Criteria for booking face-to-face interpreters or British Sign Language Interpretation is required. The following Flow Chart summarises the Telephone Interpreter Booking Process: HOW TO USE A TELEPHONE INTERPRETER (When the service user is present)  HOW TO USE A TELEPHONE INTERPRETER (When the service user is not present outgoing / incoming calls  For incoming calls If you have conferencing facilities Put your patient on hold using the conference call facilities (try to obtain your patients telephone number in case they hang up whilst on hold). Follow steps above but advise the operator that your patient is ON HOLD. If you do not have conferencing facilities: Note your patients telephone number, language and, ideally, name. Assure your patient that you will call back shortly with an interpreter. Follow steps above 5. CRITERIA FOR REQUESTING FACE-TO FACE INTERPRETERS 5.1 Face to face interpreters will only be provided if requests meet the Trust Criteria for booking face-to-face interpreters/the practitioner can provide evidence for specific clinical reasons/or sign language interpretation is required. 5.2 Criteria for Requesting Face-to face Interpreters: Patient uses non-verbal communication such as: British Sign Language DeafBlind Manual Makaton Lip Reader Child (under the age of 18) Vulnerable Adult Learning Disability Mental Health Patient has communication, cognitive or learning disability which would make telephone interpreting difficult. Bereavement or Breaking Significant News In specific areas where telephone interpretation cannot be facilitated (i.e. MRI Unit) Where conversation needs to be recorded for legal reasons. For all other reasons, divisional authorisation must be obtained  All requests for face-to-face interpreters (which do not meet the above criteria) must be authorised by Divisional Managers / Named Divisional Leads. Evidence for specific clinical reasons must be provided. 5.3 Requests for divisional authorisation should be submitted by e-mail. Requests which are granted should be documented by the Divisional Manager/Named Divisional Lead in the return e-mail. A copy of the e-mail should be forwarded to the Interpreter Services Booking Team and documented in the On-Line Booking Request Form on the Interpreter Services Web-Pages on the Intranet. 5.4 Reasons for face-to-face interpreters must be clearly specified on the On-Line Booking Request Form. Divisional Manager Authorisation must be obtained for requests which do not meet the above criteria. Reasons must be for specific clinical reasons. Requests will be monitored to ensure compliance is adhered to. 6. PROCEDURE FOR BOOKING FACE-TO-FACE INTERPRETERS The following Flow Chart summarises the Face-to-Face Interpreter Booking Process: (Must meet Trust Criteria / be based on specific clinical need) WITHIN WORKING HOURS      FACE-TO-FACE  INVOICE AUTHORISATION  6.1 On-line Booking Request Form Face to face interpreters will only be provided if requests meet the Trust Criteria for booking face-to-face interpreters/or the practitioner can provide evidence for specific clinical reasons/or sign language interpretation is required. 6.2 A face-to-face Interpreter Booking Form will be required to be completed. This is an on-line Booking Request Form and can be accessed via the Interpreter Services Web Pages on the Intranet. If you are unable to gain access to the on-line booking request form, you can contact the Interpreter Booking Team directly by telephone. Switchboard will connect you. 6.3 For details of how to access interpreter services during out-of-hours/emergency situations, please refer to Section 6 of this document. 6.4 The following table summarises the information you will be required to submit via the On-Line Booking Request Form: ON-LINE BOOKING REQUEST FORM Patients NHS NumberFree TextDirectorateDrop Down BoxReferring SpecialityFree TextDate RequiredFree TextStart & Finish TimeFree TextSiteDrop Down BoxClinic / Ward / DepartmentDrop Down BoxReason for Face-to-Face InterpreterDrop Down BoxDivisional Manager Authorisation obtained from? (attach copy of authorisation e-mail if does not meet Trust Criteria)Drop Down BoxLanguage RequiredDrop Down Box (None & List of Languages)Gender of Interpreter RequiredDrop Down Box (Male / Female)Sign Language Interpreter RequiredDrop Down Box (Yes / No)Contact NameFree TextContact Telephone No.Free TextDate Form submitted On-lineFree TextAdditional Information / RequirementsFree TextConfirmation that the request has Divisional Manager authorisationDrop Down Box (Yes / No)Top of Form 6.5 Face-to-Face Timesheet and Monitoring Form In order to allow the Trust to monitor the usage / efficiency of interpreter services, all staff who sign the Face to Face Interpreters Time-Sheet will be required to check the start and finish times and total hours claimed and complete the Quick Feedback Section on the Form. A copy of the completed Time-Sheet must be retained on the ward / department. Divisional Staff responsible for authorising payment, will need to contact the ward / department to confirm invoice details. 7. PROCEDURE OF OUT OF HOURS/EMERGENCY: 7.1 In an emergency situation it may be necessary to use staff members and adult family members to help communicate basic information about care or personal history, but they should not be used to interpret clinical information, medical terminology or to facilitate decision making about clinical care. An interpreter must be requested at the earliest opportunity. In the event of an emergency situation, consent or treatment decisions must be made in the patients best interests by a clinician and should not be delayed waiting for an interpreter. This should be fully documented in the health record of the patient. An interpreter must then attend at the earliest opportunity. 7.2 The Trusts required method of accessing an interpreter is via the telephone and should always be the first option for any staff member requiring an interpreter. If however, a request for a face-to-face interpreter meets the Trust Criteria/or the practitioner can provide evidence for specific clinical reasons / or sign language interpretation is required, staff should follow the following process during out-of-hours (between 5.00pm to 9.00am Monday to Fridays and all Weekends and Bank Holidays): OUT-OF-HOURS/EMERGENCY PROCESS           SHAPE \* MERGEFORMAT    Please Note: In the event of an emergency, the provision of an immediate Face- to-Face Interpreter is unlikely (although Language Empire will do their best to source an urgent interpreter, this could take up to 12 hours) Please access Telephone Interpreter Services (Language Line: #6 888 or 0800 9179031) 8 CONSENT 8.1 The legal position regarding obtaining a persons consent to treatment is that the treating/operating clinician has a duty to ensure that a valid consent to the proposed treatment/operation has been given by the patient. Where there is a need for communication support, telephone interpretation should be used. Face to face interpreters will only be provided where the practitioner can provide evidence for specific clinical reasons or Sign Language Interpretation is required. 8.2 If the patient is not offered as much information as they reasonably need to make their decision, and in a form they can understand, their consent may not be valid. Consent must be given voluntary: not under any form of duress or undue influence from health professionals, family or friends. 8.3 In an emergency situation it may be necessary to use staff members and adult family members to help communicate basic information about care or personal history, but they should not be used to interpret clinical information, medical terminology or to facilitate decision making about clinical care. An interpreter must be requested at the earliest opportunity. In the event of an emergency situation, consent or treatment decisions must be made in the patients best interests by a clinician and should not be delayed waiting for an interpreter. This should be fully documented in the health record of the patient. An interpreter must then attend at the earliest opportunity. 9 Procedure for Accessing Translations 9.1 The Trust is committed to providing patient information in differing forms to support the needs of the patients accessing our services. Information can be translated in to other languages or other formats (including large print, audio and braille). If a patient/carer requires the translation of any Trust document: 9.2.1 First check that the document has not already been translated by searching the Trust Intranet. If it is available print off a copy and give or send to the patient / carer. 9.2.2 Ask the patient/carer whether they would prefer to have the document explained in their first language by an interpreter. This can be done by telephone or by an appointment. If there is difficulty in communicating with the patient, a telephone interpreter should be used as described in the Telephone Interpreting procedure. 9.2.3 If the patient/carer requires a written translation for any documentation, e-mail Patient Information Administrator, Membership and Engagement Department, Tel: (01942) 773106, E-mail: (InterpreterServices@wwl.nhs.uk). You must advise the patient / carer of the time-scale for translation (at least 3 to 5 working days). 9.3 The following Flow Charts summarises the process for obtaining information in other formats, including audio, large print, braille or other languages: OBTAINING INFORMATION IN OTHER LANGUAGES  Requests for Trust Letters / Correspondence / Leaflets etc. to be translated into other languages to be e-mailed to Patient Information Administrator, Membership and Engagement Department, RAEI Tel: 01942 773106 E-mail: (Translation.Services HYPERLINK "mailto:janet.duffy@wwl.nhs.uk" @wwl.nhs.uk) Where possible electronic word document to be e-mailed to Patient Information Administrator (InterpreterServices HYPERLINK "mailto:janet.duffy@wwl.nhs.uk" @wwl.nhs.uk) (paper copy will be accepted if no electronic copy available) Translated documentation to be forwarded to Ward / Department. Ward/Department to forward to Patient. OBTAINING INFORMATION IN OTHER FORMATS (AUDIO / LARGE PRINT / BRAILLE) 10. GUIDANCE DOCUMENTS 10.1 Attached to this Standard Operating Procedure are a number of Guidance Documents please refer to the following appendices: APPENDIX 1Frequently Asked Questions APPENDIX 2Checklist and Guidelines for working with Interpreters. APPENDIX 3What to do when talking to a person with a hearing impairment. APPENDIX 4What to do when talking to a person who is visually impaired. APPENDIX 5What to do when talking to a person with a speech impairment / learning difficulty. APPENDIX 6What to do when talking to a person who is Deafblind. APPENDIX 7What to do when talking to a person whose first language is not English.  11 Human Rights Act Implications of the Human Rights Act have been taken into account in the formulation of this document and they have, where appropriate, been fully reflected in its wording. 12 Accessibility Statement This document can be made available in a range of alternative formats e.g. large print, braille and audiocassette. For more details, please contact the Trusts Patient Information Administrator, Membership and Engagement Department on 01942 773106 or email  HYPERLINK "mailto:InterpreterServices@wwl.nhs.uk" InterpreterServices@wwl.nhs.uk APPENDIX 1 FREQUENTLY ASKED QUESTIONS GENERAL:          TELEPHONE INTERPRETERS:              FACE-TO-FACE INTERPRETERS:        TRANSLATION:    APPENDIX 2 Checklist & Guidelines for Working with Interpreters DO: Allow enough time for the telephone / face-to-face interview. For example meetings can take almost twice as long if you are working through an interpreter. Indicate how long the session is likely to run. Be aware of seating arrangements If using a face-to-face interpreter, a triangle with client and interpreter next to each other and facing the healthcare worker at the apex is best. Be patient. Try to speak directly to the patient / carer rather than the interpreter (if present). Look at the patient / carer. Emotions like feeling vulnerable, angry, upset, intimidated, frightened are often easily read if you take the time. Respect the interpreters independence, e.g. never ask if the patient / carer is telling the truth. Speak in clear sentences and pause often. Let the interpreter interrupt you if necessary for clarification. Take extra care in explaining policies, procedures, regulations and reasons for asking sensitive questions. Check periodically during the interview and at the end if everything is clear. Be sensitive to the demands and pressures on the Interpreter and keep your sentences to a minimum. Give as much feedback to interpreters and service managers as possible. DO NOT: Use jargon or euphemisms waterworks for bladder can be confusing and unhelpful, so can colloquialisms, such as pop up on the couch. Make assumptions about the patient/carer, because of dress or ethnicity. Stereotyping is misleading and discriminatory. Ask the patient why they do not learn English. This can be offensive and unhelpful, especially if you do not know about their particular circumstances. Be suspicious if a brief simple sentence becomes a long and complicated one in translation, or vice versa. Remember talking louder doesnt help. If the person doesnt understand it is your responsibility to explain in simpler terms not the interpreters. If you need to talk directly to the interpreter they should explain to the patient about the nature of the conversation. Always ensure that the patient is given an opportunity to ask any questions during or after the consultation. Interpreting Practice When using an interpreter there are 3 stages to the process to consider. a) Pre-consultation b) Consultation c) Post-consultation In order to ensure a good outcome the following should be considered when using either telephone or face to face: Pre-Consultation: The patient is informed that a telephone interpreter will be used. The patient has given consent to an interpreter being used. You have allowed for extra time, since a two way communication may take considerably more time. A suitable location is being utilised with the necessary telephone equipment. If a face-to-face interpreter is being used, the interpreter will need to be aware of the location of the assignment, for example a consulting room on a particular floor. When using a telephone interpreter, prepare a checklist of the information you need to exchange so the three-way conversation can be as focused and cost effective as possible since calls are charged by the minute. This will help to prevent the need to call back again. Interpreters should always be briefed in advance about the areas that will be discussed and any literature that you are using shared with them. Consultation: Welcome and brief the interpreter about sessions aims/objectives and the specific information that you require from the patient. If you are conducting this with the patient present, always ask the interpreter to inform the patient of what you are doing. Reposition the seats so that you are in direct line of sight with the patient. You may find it helpful to place the chairs in a circle, or triangle. It is also advisable to ask for the cultural factors that may have to be taken into consideration or that may affect the interview. Ensure that the patient is comfortable and relaxed before the session begins. Start by giving an overview of the session and explain the purpose of the session and how it will proceed. It is also good practice to re-assure the patient of the Code of Ethics. Speak slowly and clearly, avoiding technical jargon and slang words. It is best to use plain English at all times. Use your normal tone of voice. Always speak directly to the patient and not the interpreter (if one present) and use the first person e.g. how are you feeling? Pause after 2 or 3 seconds to allow the interpreter to relay the information. It is good practice to summarise the information periodically to ensure that the patient has understood the key message. Stop speaking if the interpreter starts speaking. Post Consultation: It is very important to thank the interpreter. You should clarify any matters arising from the interview and answer any questions they may have. Lastly it is good to examine if there are any ways the interview process could have been improved. APPENDIX 3 What to do when Talking to a Person with a Hearing Impairment Communication is the biggest barrier for people with hearing loss. Hearing loss can occur in many different ways and to varying degrees. Some people are deaf from birth. Some people gradually lose their hearing, as they get older. Other lose their hearing suddenly through illness or accident. It is important to remember that people with hearing loss may listen with their eyes and lip read. Good communication can make all the difference and there are a number of strategies and coping mechanisms that can help to improve conversations. Simple Tips to remember when talking to someone with Hearing Loss: Make sure the person is looking at you before you speak. If necessary, attract their attention by touching their arm of shoulder. Always ask the patient what is their preferred method of communication British Sign Language (BSL), lip reading, Makaton. Note lip readers only pick up on average 30% of words. Ensure there is good lighting in the room. Ensure your face is well lit. Do not stand with your back to a bright source such as a window or lamp. Try not to wear tops that are multi coloured or have lots of patterns. Reduce background noise and visual disturbance as much as possible. Look directly at the person. Speak clearly and at an even pace. Do not shout or exaggerate your lip movements. Use natural gestures and facial expressions to support what you are saying. Stand 3-6 feet away. Keep your mouth clearly visable. Check whether the person uses any specific signs. Stop talking if you have to turn away or write notes. Allow time for the person to absorb what you have said, and check that they have understood. If there seems to be a misunderstanding, relax, repeat what you have said, re-phrase use plain words avoid jargon. Write things down if needed, but ask first. Use open ended questions (which will encourage a response and ensure the deaf person understands you). Try not to feel irritated when your communication method does not work. Relax, look straight at them and try again. Letter heading, leaflet and information sheets should include phone, minicom (if available), fax and email numbers to facilitate responses from people who are deaf or hard of hearing. Some will also use mobile phones for text messages. Technical Aids: 1. Portable Induction Loops An Induction loop system helps hearing impaired people who use a hearing aid or loop listener hear sounds more clearly because it reduces or cuts out background noise. Portable induction loops are available for use on all Trust Hospital Sites. 2. Text Phone Textphones have a small display screen, and a keyboard, so you can type what you want to say and read what is being typed from another textphone in reply. A textphone service is available within Patient relations. If you have a textphone you can call someone else with a text phone directly. 3. Typetalk / NGTRelay Text relay is a group of relay assistants waiting to relay phone conversations between a text-user and a phone-user. When making a phone call a text- user 'talks' by typing to the relay assistant who speaks their words to the phone-user, and then the relay assistant types the phone-user's spoken reply to the text-user. This service is available 24 hours a day, 365 days a year and is charged at standard telephone rates. Patients / Relatives can access the Trusts Switchboard by utilising the Typetalk System. APPENDIX 4 What to do when Talking to a Person who is Visually Impaired Address and Greetings: When you meet a visually impaired person, you need to start the conversation, regardless of the age, sex or position of the person, since you are the one who sees better. Greet the person in a normal tone of voice and you may touch the person lightly on the forearm to make him understand that you are speaking to him. If you know each other, it is a good idea to call the persons name first and then to identify yourself (Do not expect that a visually impaired person will always identify you by voice.) The interaction can be very natural. And do not be afraid to shake hands with the person blindness is not contagious. Always make sure that you address the person before you touch him. In the other case the visually impaired person would take fright, just try to imagine. Saying good-bye is similar. You need to make sure that the visually impaired person knows you are leaving. No French leaving, no uncertainty. It would be very impolite to let the visually impaired person keep talking to you when you have already gone. Conversation: When speaking, face each other. Although a visually impaired person cannot see, he can tell when you turn your face somewhere else. Sometimes, he even can tell whether you are smiling, nervous, focused or bored by the tone of your voice. People generally control their facial expressions and gestures more than their voice. When you speak to a purblind person, try to position yourself in such a way that light falls onto your face, as the purblind person will be able to see you better and will not be dazzled by direct light. When talking to a visually impaired person, you do not need to try hard to avoid such expressions as "read", "look", "see you soon" etc. Visually impaired people do not mind such words. Do not rely on gestures and try to express and describe exactly what you want to say. Expressions such as "there", or "that one" do not carry much meaning for the visually impaired. When speaking to a visually impaired person, some people automatically raise their voice, exaggerate articulation or speak in simple sentences. It sounds comical and unnatural. There is also a myth that you have to speak all the time when you are in a company of a visually impaired person, so that he knows that you are there. Just think of visually people as ordinary people, the only difference being that they cannot see. Walking with a Visually Impaired Person: A visually impaired person, especially in unknown surroundings, will very much appreciate the help of a sighted person. Just make sure, that you never drag a visually impaired person by his sleeve or push him in front of you. This would not only be rude but it would also violate his safe walking. The best and most natural way of walking is when you offer the person your arm, which he holds with one hand above your elbow and let him walk more or less one step behind you, usually on the side that he prefers or the safer one. Thus the visually impaired person will be able to promptly react to all the obstacles in the way (kerbs, steps, doors, branches, potholes, uneven surface, etc), which you should also indicate in words for him, e.g.: "Mind the step!". Bear in mind, that you only offer you help, which means that the visually impaired person can but does not have to accept. There are places, which the visually person knows very well and where he can walk with his white stick completely independently. On the other hand, there are many situations, such as crossing a busy road or orientation in unknown surroundings or in a shopping centre, where the visually impaired person needs your help to manage safely. In such situations, your help will be more than welcome. Narrowed Space, Going through the Door, Sitting Down: Walking straight ahead on an even surface is not difficult. However, there are always some obstacles in the way that can cause problems. In all circumstances, there is a golden rule which says that the guide is always one step before the visually impaired person. In the case of narrow spaces, the guide moves his arm behind his back and thus lets the visually impaired person know that he should line up behind him. At the same time, the guide can tell the person what is happening. We might need to walk sideways in the narrowest part. Going through a door can be achieved in several different ways. The guide and the visually impaired person need to be well coordinated in order to do it smoothly. It is always better when the visually impaired person is on the side of the hinges. The guide uses his free hand to open the door. Then, he holds the door handle with the hand which the visually impaired person holds to which means that the visually impaired person will easily find the door handle himself and close the door behind him. Thus they will go through the door smoothly without any unnecessary turning and going back. Every obstacle becomes less dangerous when the visually impaired person knows about it in advance, if he can directly touch it and thus have it under control. When there are steps, kerbs and similar obstacles, we always approach them perpendicularly. Before you get to the stairs, let the visually impaired person know what is coming and do not forget to tell him whether the steps lead up or down. When you get to the first step, slow down or stop completely so that the person knows where exactly the beginning of the steps is. It is not necessary to report how many steps there are, the visually impaired sense the steps by the movement of the arm of the guide who is in front of them. When you get to the last step, let the person know about it and slow down. It is better if the visually impaired person walks on the side of the handrail, although he might not need to use it. Sitting down at a table starts with the guide finding free seats and telling the visually impaired person what type of seat it is (chair, armchair, bench). The guide places his hand on the armrest and the visually impaired person slides his hand down the guides arm to find the armrest himself. Then the visually impaired person checks the seat himself, finds the edge of the table and sits down. The same way of sitting down can be used when using public transport. The Guides Role: When you walk with a visually impaired person, you become his guide. This, however, does not mean that you make decisions for him and that you act on his behalf. Some people try to communicate with the visually impaired person through his guide: "Young lady, can the gentleman sign this himself?" Make sure that you always rouse such conduct or you can try to make a joke of it: "Ask him directly, my husband will not bite you" Sighted people are used to starting any communication with eye-contact. When there is no eye-contact, they often feel a little bit confused. This might explain their behaviour, yet it does not excuse it. Avisually impaired person is a person of his own right! It is very helpful when the guide describes to the visually impaired person the surroundings in which they find themselves (landscape, street, room, etc.). To be able to give a concise account of the surroundings demands certain practice and maybe even some talent. Do not be afraid to tell the visually impaired person about little accidents that he is not aware of, e.g. when you see that his tie is smeared with sauce after lunch. In such a situation it would not be a very good idea to keep silent, on the contrary. Tell the person about it tactfully and then help him to clean it. The fact that the person is visually impaired does not mean that he does not mind what he looks like. Other Tips and Recommendations: When dealing with a visually impaired person, act naturally. Nothing should be forced. The above described techniques may vary according to individual needs and the habits of the visually impaired person. Follow customary manners. Try to ensure that the acoustics of the place where you are with the visually impaired person are acceptable. If possible, do away with unnecessary noise and disturbances. Help to do away with possible obstacles for the visually impaired person (open drawers, half open display cases and shop windows, holes in the ground without a fence around, branches or parts of scaffolding sticking out at the head level, etc.). Avoid expressions of excessive sympathy and actively help where necessary. APPENDIX 5 What to do when Talking to a Person with a Speech Impairment / Learning Difficulty Speech impairments range from slight to severe, and the impairment may be related to another disability, such as cerebral palsy, a brain injury, or hearing loss. Tips: If the person's speech is difficult to understand, politely ask the person to repeat or rephrase. Be patient. Try not to interrupt or complete sentence for the person. Try not to hurry the person. This may make the impairment worse. You may find it helpful to ask questions that require short answers or a nod of the head - be patient, allow plenty of time for information to be assimilated If you are not understanding what the person is saying, let the person know. If you continue to have difficulty, offer pen and paper if the person is physically able to write. Asking the person to rephrase the thought or spell out a particular word may help. Listening to someone struggling with speech can often feel embarrassing. Keep calm and watch the persons lips. A learning difficulty is a disorder which affects the manner in which individuals with normal or above average intelligence take in, retain, and express information. An individual may have a deficit in one or more of the following areas: oral expression, listening comprehension, written expression, reading skills, reading comprehension, mathematical calculation, organization, or problem solving. A learning disability is presumably due to central nervous system dysfunction. Tips: When giving instructions or directions, break large tasks into small sequential steps It may help to write instructions down. It may help to read aloud information that is in print. Demonstrating how to do a task may be better than verbally explaining it alone. Give frequent and positive feedback. Ask questions to insure understanding. Allow adequate time for a response. Notify the person of changes well in advance whenever possible. Structure practical tasks in clearly defined steps. APPENDIX 6 What to do when Talking to a Person who is Deafblind Lack of the ordinary warning faculties of sight and hearing means that any approach to a person who is deafblind should be gentle and never sudden otherwise the person will become startled and frightened. Information: Without sight and hearing there is no way of knowing what is passing ones immediate vicinity and therefore a perpetual sense of worrying what is happening. To lessen this, it is necessary that time should be taken to explain any movement, e.g. if the patient is required to move to another place, the reason should be given. All treatment should be fully explained to ensure the patients co-operation. Indentifying oneself: Unless you have some unmistakable identification march, such as a ring or a brooch, you should always give your name at each approach or some agreed sign, such as a double squeeze of the hand, so that the individual knows at once to whom they are speaking. Where possible check with the person / family if there any specific signs used by the individual. These can reduce stress and anxiety and aid communication. Some people use Braille or Moon to communicate, or Tadoma (with this method the person feels the speakers lips and the speech vibrations from the speakers throat). Listen carefully to what the person says. Sheer nervousness may well be making it very hard for them to express what they mean and if no notice is taken, that sets up a feeling of despair. Remember always how utterly isolated such a person is and how much they need to be convinced that they are amongst friends. Again direct communication is vital. Interpreting by a third person can lead to an untrue diagnosis. If a Deafblind Person is in Hospital: People who cannot see or hear are even more sensitive about intimate hospital routines and it is necessary to assure them positively that they can ask for what is needed and must not be shy. If not bedridden, a patient should be able to reach the toilet easily. Be sure the person knows where all personal possessions are and that they are never moved from place to place. Ensure that they can locate and use emergency call bell. APPENDIX 7 What to do when Talking to a Person whose First Language is not English It is not always easy to determine how much someone can understand this applies to the patient/family/carer. Some tips to support your initial communication with persons whose first language is not English: Speak clearly and in plain English. Give time for responses (30 seconds is not unusual). If you do not receive a response this may indicate that the question has not been understood and you may: Repeat the question. Ask the person to repeat the question back to you. If the person cannot respond or repeat the question an interpreters assistance may be required. The following questions support you in determining the language competency of persons who speak English as their second language: Do you want or need an interpreter? Even if the answer is no, continue to assess the need for an interpreter by asking questions such as: Can you tell me where you were born? How long ago did you move to / this community? Are you satisfied that we can go ahead in English or do you think we need an interpreter? Even if the patient/carer answers all the questions there is no guarantee that their level of English is/will be sufficient.     TW11/023 (SOP) Interpreting and Translation Services Version 3 Inclusion and Diversity Lead Approved: PARC May 2017 Next review date: May 2020 PAGE   PAGE \* MERGEFORMAT 13 AT ALL TIMES, STAFF MUST TREAT EVERY INDIVIDUAL WITH RESPECT AND UPHOLD THEIR RIGHT TO PRIVACY AND DIGNITY. Telephone Language Line Tel: #6 888 Or 0800 9179031 Select Option 1: Telephone Interpreter You will be connected to an Operator State Directorate ID Code (Divisional ID Codes available on Wards/Departments or on Interpreter Services Web Pages on Intranet) State Name of Trust / Name of Directorate / Full Name Language Required You will be connected to an Interpreter Brief Interpreter / Specify any Special Instructions Explain communication method being used: Telephone with Loudspeaker Facility Telephone passed back and forth Mobile / Cordless Telephone Dual Handset phone / Headset When the call is complete, State End of Call Make note in Patients Case notes Monthly Telephone Usage Monitoring Report generated by Language Line. Forwarded to I&D Lead Invoice sent to Divisional Manager / Leads for authorisation. Authorised Invoices returned to Accounts for payment. Language Line sends Monthly Invoice to Accounts for Payment Monthly Reports forwarded to designated Divisional Managers / Leads for monitoring Telephone Language Line Tel: #6 888 Or 0800 9179031 Select Option 1: Telephone Interpreter State Language Required / State Directorate ID Code / Name of Trust / Your Name (Divisional ID Codes available on Wards/Departments or on Interpreter Services Web Pages on Intranet) Explain that you the patient is not with you You are contacting the patient by telephone Give the operator the patients name and telephone number Stay on line whilst the operator connects you to a trained interpreter (about 30 seconds) Note the Interpreters ID Code. Introduce yourself and brief the interpreter. Explain the operator is phoning your patient. And give the interpreter the first question or statement. The operator will introduce the patient into the call Give the interpreter time to interpret between you and your client. Continue the conversation. Let your client and the interpreter know when you have finished. Does your request for a Face-to-Face Interpreter meet Trust Criteria? No Yes Complete On-line Booking Request Form Access via Interpreter Services Web-Pages on Intranet (Evidence of divisional authorisation required for requests based on clinical need which are not specified within Trust Criteria) Use Telephone Interpreter Service Submit on-line to Interpreter Services E-mail In-Box For requests which do not meet Trust Criteria Forward copy of e-mail granting divisional authorisation. Interpreter Services Team collate and process booking Interpreter Attends Quick Feedback Section on Language Interpreter Time-Sheet to be completed by Member of Staff authorising Time-Sheet Start and Finish Times and Total Hours claimed to be checked by ward / department staff. Time-sheet authorised Confirmation of booking sent via e-mail to ward / department Copy of completed Time-Sheet to be retained on Ward / Department Interpreter Dismissed Monthly Invoice sent to Accounts for Payment (copy of time-sheet attached) Invoices sent to Divisional Managers for monitoring and authorisation (with copy of time-sheet) Invoice signed and returned to Accounts for Payment Monthly Usage Monitoring Report sent to Designated Divisional Leads Monthly Usage Monitoring Report generated by Interpreter Services. Forwarded to I&D Lead Nominated Divisional Staff to monitor / contact Ward / Department to confirm invoice details. Contact Switchboard Ask to speak to the Duty Matron or the Bed Manager/Site Co-ordinator. Switchboard will advise you who is available at that time and connect you. Maternity / Emergency Services & Theatre Staff to contact their Shift Leader Paediatric Staff to contact the Paediatric Bleep Holder Request Authorisation for the Face-to-Face Interpreter Authorisation Granted Authorisation Declined Use Telephone Interpreter State the following information: Patients NHS Number Directorate Date & Time Required Location Language Required Gender of Interpreter Contact Name & Telephone Number Duty Matron or Bed Manager/Site Co-ordinator or Maternity / Emergency Services / Theatre Shift Leaders will request Language or Sign Language Interpreter via telephone / on-line booking portal. Face to Face Interpreter Booked Patient Information Administrator to contact Translation Services. Quote to be obtained. Division requesting translated documentation informed of cost. The cost of translating information into other languages will be met by the requesting division. Documentation to be translated as requested (a minimum of 3 to 5 working days turnaround time required by Translation Services) Invoice to be sent to Accounts Invoice sent to Divisional Manager for monitoring and authorisation Invoice signed and returned to Accounts for payment. Where possible electronic word document to be e-mailed to Patient Information Administrator (Paper copy will be accepted if no electronic copy available) Translated document to be produced and forwarded on to patient etc. by Patient Information Administrator Requests for Trust Letters / Correspondence / Leaflets etc. to be translated into audio, large print and Braille to be e-mailed to Patient Information Administrator, Membership and Engagement Department, RAEI Tel: 01942 773106 E-mail: (Translation.Services HYPERLINK "mailto:janet.duffy@wwl.nhs.uk" @wwl.nhs.uk) When is an interpreter required? If the patient does not speak English. If the patient speaks English as a second language but there may be barriers to understanding. The patient has a sensory impairment (hearing or visual) and requires specialist support. The patient has a learning difficulty / impairment and requires specialist support. Can friends / relatives be used as interpreters? NO In the interests of accuracy, confidentiality and accountability, the use of family or friends is not acceptable in clinical situations. The patient should always be offered the services of a professional interpreter and the reasons for this explained. Staff should be aware that although relatives and friends may speak the same language, they might not be skilled or competent enough to interpret in a health care setting. Relatives and friends may have conflicting thoughts/ideas Confidentiality may be breached The service user may or may not feel able to speak freely The untrained interpreter may add or omit information They may have difficulty with medical terminology There may be difficulty in giving bad news Misinformation can lead to misdiagnosis May open the Trust to potential litigation. What if a patient refuses an interpreter and chooses friends / relatives to interpret? There may be some service users who simply refuse to use an interpreter, but who may wish to rely upon a spouse, child, family member or friend. The Trust cannot force a person to use an accredited interpreter however the member of staff dealing with the situation will need to explain the risks for not using one. A telephone interpreter should be used to advise the patient that: An approved Interpreter is recommended and the Trust cannot take responsibility for any errors caused by the use of anyone other than an approved Interpreter. The Trust will only pay for approved Interpreters booked by our approved suppliers. This must be documented within the patients notes Can friends / family be used as interpreters for children? NO If the patient is a child (up to the age of 18), a professional face-to-face interpreter must be used. This does not prevent the family from being present to provide support. Can staff be used as interpreters? NO In the interests of accuracy, confidentiality and accountability, the use of staff is not acceptable in clinical situations. The patient should always be offered the services of a professional interpreter and the reasons for this explained. Failure to provide a qualified interpreter may leave the Trust open to challenge should the information given by a staff member prove to have been misconstrued or misunderstood. Bilingual staff should only be used to help communicate basic information about care or personal history, signposting and basic information such as visiting times etc. Staff must not be used to interpret clinical information, medical terminology or to facilitate decision making in relation to care. If staff members / clinicians are used to interpret in any of these situations, then it should be with the full consent of the patient and person providing the interpretation. This should be fully documented in the patients health records. Can use On-Line Translation Websites be used? NO Although free on-line translation websites may be convenient for translating simple words or phrases, for example whilst on holiday, eating at a restaurant etc. not all text may be translated accurately. On-line translations are provided by machine translation. No human intervention is involved. All free on-line translation websites contain a disclaimer, that they will not take responsibility for incorrect or inaccurate translations. On-line translations offer no confidentiality; only a rough translation; and no form of quality control (accuracy cannot be guaranteed). On-line translations do not translate word for word. They scan related documents, websites etc. and based on this material, generate suggested text. How should consent to treatment be obtained from a patient? Where there is a need of communication support to obtain consent for treatment, telephone interpretation should be used. Face to Face interpreters will only be provided in extreme circumstances, where the practitioner can provide evidence for clinical reasons or sign language interpretation is required. Who is responsible for booking interpreter services? Once it has been agreed by the ward / department that an interpreter / written translation is required, it is the responsibility of individual wards and departments to instigate the most appropriate communication support for their patients. . Who pays for interpreter services? The cost for interpreter services will be met by the requesting divisions. Invoices for telephone interpreters will be supplied on a monthly basis and it will be the responsibility of the authorising Divisional Manager / Team to check that the services were appropriately provided before sanctioning payment. Invoices for face-to-face interpreters and translation services will be supplied on an individual patient basis and it will be the responsibility of the authorising Divisional Manager / Team to check that the services were appropriately provided before sanctioning payment. . Can I access a telephone interpreter out of normal working hours? Language Line operates 24 hours a day, 7 days a week, 365 days a year. How can I explain to the patient / relative that we will be using a telephone Interpreter? On each ward / department, laminated explanatory information (translated in the top languages used) will be shown to the patient / relative, explaining that we will be using a telephone interpreter. How do I know what language the patient speaks? On each ward / department, laminated Language ID Sheets will be available for patients to point to which language they speak. There are by no means comprehensive lists, as there are over 200+ languages / dialects but they will provide some assistance with the most requested languages. How is my telephone call connected to an interpreter? You dial a designated number, provide your account information, and request the language needed. In seconds you will be connected to an interpreter. Do I need special telephone equipment / room? Any of the following telephone equipment can be used: Telephone with Loud Speaker Facility Mobile / Cordless Phone with Loud Speaker Facility Telephone being passed back and forth Dual Handset Phone Dual Head Phone Set If you are aware that a telephone interpreter will be used, where possible please ensure that a suitable location / room is utilised with the necessary telephone equipment (for example: arrangements already in place for patients attending out-patient appointment staff already aware of patients needs for an interpreter). How long does it take to reach an interpreter? You will be connected to an interpreter within seconds once account information has been given. Occasionally the connection time for a less commonly requested language may be slightly longer. How can I identify the language that a patient is speaking? If you do not know which language to request, simply say, Help and you will be automatically transferred to a representative trained to help in language identification. Once I reach an interpreter, what happens if I accidentally hang-up? Unfortunately, this does happen occasionally. Language Line will make every attempt to reach you so you can complete your transaction with your patient. If time does not permit, simply re-dial Language Line and request an interpreter. You will be connected to an interpreter within seconds once account information has been given. What if I request the wrong language? If you find that the language you requested is incorrect, simply ask the interpreter to route you back to Language Line for assistance. If you know the correct language, say the name of the language and proceed as usual. If youre unsure of the correct language, say, Help. You will automatically be transferred to an operator trained to help in language identification. What happens if we have a problem hearing one another on a call? Relay the appropriate instructions to the Limited English Speaker as to how you will re-establish contact. Say end of call to your interpreter and hang up. Then redial Language Line Services and say, Help. Your call will be immediately connected to an operator whom you can request to place the call and monitor it for sound quality. What should I do when the interpreter joins the conversation? Summarise what you wish to accomplish and give any special instructions to the interpreter. Dont assume that the interpreter or Limited English Speaker knows more about your organisation or its procedures than what you tell them. Take the lead in the conversation by giving the interpreter specific questions to relay. Group your thoughts or questions to help the conversation flow naturally and quickly. For example, ask for an address and phone number as one question. I need an interpreters name How do I get it? When the interpreter joins the call, you will be given a unique Interpreter Identification Number for your interpreter. Although interpreters will also identify themselves by first name, the Identification Number is how Language Line tracks their interpreters. Write down the Interpreter Identification Number for future reference. Do I need to document anything in the patients notes? YES - When the call is complete state End of Call. Make a note in the patients health records that telephone interpretation has been used. Write down the Interpreters Identification Number and the language spoken. Make a note of the date, time and approximate duration of call. How do I book a face-to-face interpreter? The Trusts required method of accessing an interpreter is via the telephone and should always be the first option for any staff member requiring an interpreter. Face to face interpreters will only be provided if requests meet the Trust Criteria for booking face-to-face interpreters / the practitioner can provide evidence for specific clinical reasons / or sign language interpretation is required. Requests for Face-to-Face Interpreters are made by completing the on-line booking request form on the Interpreter Services Web-Pages on the Intranet. If your request does not meet Trust Criteria , you will need to submit evidence that divisional authorisation has been obtained (i.e. forward copy of e-mail showing that divisional authorisation has been obtained to the Interpreter Services Booking Team). What If I cannot gain access to the on-line Booking Form? If you are unable to gain access to the on-line booking request form, you can contact the Interpreter Booking Team directly by Telephone. Switchboard will connect you. Contact Details will be available on the Interpreter Services Web Pages on the Intranet and in all Departmental Resource Packs. How do I cancel a face-to-face interpreter? Contact the Interpreter Services Booking Team: Telephone: Switchboard will connect you E-Mail:  HYPERLINK "mailto:Interpreter.Services@wwl.nhs.uk" Interpreter.Services@wwl.nhs.uk How do I book / cancel a face-to-face interpreter in an emergency / out of hours? Please Note: In the event of an emergency, the provision of an immediate Face-to-Face Interpreter is unlikely (although Language Empire will do their best to source an urgent interpreter, this could take up to 12 hours) Please access Telephone Interpreter Services (Language Line: #6 888 or 0800 9179031) If an interpreter is required out-of-hours and telephone interpretation deemed inadequate, staff should contact the following individuals for authorisation/processing booking requests: Maternity Services Staff Maternity Shift Leader; A&E/Emergency Services Staff Emergency Services Shift Leader; Theatre Staff Theatres Shift Leader; Paediatric Staff Paediatric Bleep Holder. Who needs British Sign Language (BSL)? People who are deaf or hard of hearing. British Sign Language, or BSL is a type of communication that adheres to its own grammatical rules, utilising hand movements and shapes as well as facial expressions to convey a message rather than using words. What is the criteria for a face-to-face interpreter? Face to face interpreters will only be provided if requests meet the Trust Criteria for booking face-to-face interpreters / the practitioner can provide evidence for specific clinical reasons / or sign language interpretation is required. Patient uses non-verbal communication such as: British Sign Language DeafBlind Manual Makaton Lip Reader Child Vulnerable Adult Learning Disability Mental Health Patient has communication, cognitive or learning disability which would make telephone interpreting difficult. Bereavement or Breaking Significant News In specific areas where telephone interpretation cannot be facilitated (i.e. MRI Unit) Where conversation needs to be recorded for legal reasons. For all other reasons, divisional authorisation must be obtained For all other reasons, divisional authorisation must be obtained How do I obtain Divisional Authorisation? All requests for face-to-face interpreters (which do not meet the above criteria) must be authorised by Divisional Managers / Named Divisional Leads. Evidence for specific clinical reasons must be provided. Requests for divisional authorisation should be submitted by e-mail. Requests which are granted should be documented by the Divisional Manager / Named Divisional Lead in the return e-mail. A copy of the e-mail should be forwarded to the Interpreter Services Booking Team and documented in the On-Line Booking Request Form on the Interpreter Services Web-Pages on the Intranet. Reasons for face-to-face interpreters must be clearly specified on the On-Line Booking Request Form. Divisional Manager Authorisation must be obtained for requests which do not meet the above criteria. Reasons must be for specific clinical reasons. Requests will be monitored to ensure compliance is adhered to. For all other reasons, divisional authorisation must be obtained What do I do if a patient requires a leaflet / letter in large print / audio or braille? Requests should be directed to the Patient Information Administrator in the Membership and Engagement Department. Tel: 01942 773106 / E-mail: Translation.Services@wwl.nhs.uk What do I do if a patient requires a leaflet / letter in another language? Requests should be directed to the Patient Information Administrator in the Membership and Engagement Department. A minimum of 3 to 5 working days turnaround time is required. The Patient Information Administrator will obtain a quote from Translation Services. The requesting Division will be advised of the cost and then a translated copy obtained. Who pays for translated patient information? The cost for translating information in to other languages will be met by the requesting divisions. Invoices for translation will be supplied on an individual basis and it will be the responsibility of the authorising Divisional Manager / Team to check that the services were appropriately provided before sanctioning payment. There is no cost for translating information into large print, audio or braille. This service is provided by the Trusts Patient Information Administrator.  "GHIQVZ]_`akmnopųpaOaų=#h.h5CJOJQJ^JaJ#h.hgV5CJOJQJ^JaJh.5CJOJQJ^JaJ#h.h.5CJOJQJ^JaJhhd:OJQJ^J#h.hd:5CJOJQJ^JaJ#h.h!5CJOJQJ^JaJ#hhd:5CJOJQJ^JaJh05CJOJQJ^JaJh v5OJQJ^JhCo5OJQJ^J)jh.5OJQJU^JmHnHu"HIQAkd$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tT $IfgdO $IfgdLgdegdQ`amoTK $IfgdLkd$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tT $IfgdOop]TK $IfgdO $IfgdLkd$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tTɼzm[I<*#h9h95CJOJQJ^JaJhhd:OJQJ^J#h9hd:5CJOJQJ^JaJ#h9h05CJOJQJ^JaJhhR <OJQJ^J#hhR <5CJOJQJ^JaJh.5CJOJQJ^JaJ#hhd:5CJOJQJ^JaJh05CJOJQJ^JaJhh0OJQJ^J#h.h05CJOJQJ^JaJ#h.h.5CJOJQJ^JaJ#hh05CJOJQJ^JaJ]TK $Ifgd $IfgdLkdy$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tT]TK $IfgdO $IfgdLkdL$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tT]TK $IfgdO $IfgdLkd$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tT   + 3 7 8 9 N W X Y q t u v |ΎjΎj[I#hHh!5CJOJQJ^JaJhgV5CJOJQJ^JaJ#h9hd:5CJOJQJ^JaJ#h9h**5CJOJQJ^JaJ#h9h!5CJOJQJ^JaJh95CJOJQJ^JaJ#h9h5CJOJQJ^JaJhhd:OJQJ^J#hhd:5CJOJQJ^JaJhh0OJQJ^J#h9h05CJOJQJ^JaJ  8 ]TTK $Ifgd9 $IfgdOkd$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tT8 9 N X ]TK $IfgdO $IfgdLkd$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tTX Y q u ]TK $IfgdO $IfgdLkd$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tTu v ]TKKK $IfgdO $IfgdLkdk$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tT # , / 7 8 9 ? C D E F Y [ c d ¾°mZJ7$hHhR <5B*OJQJ^Jphh95B*OJQJ^Jph$hhR <5B*OJQJ^Jph$hhd:5B*OJQJ^Jphh5CJOJQJ^JaJh,:|5CJOJQJ^JaJ#hhd:5CJOJQJ^JaJhhd:5OJQJ^Jhd:hhd:OJQJ^J#hHh 5CJOJQJ^JaJh 5CJOJQJ^JaJhd:5CJOJQJ^JaJ / : E ][[RIR $Ifgd $IfgdOkd>$$IfTl      S0;%L2  t0[! [! [! [! [! [! %644 l` apyt0tTE F [ d ?66 $IfgdOkd $$IfTl      7F;%LT  t0[! [! [! [! [! [! %6    44 l` apyt0tTd e ]TT $IfgdOkd $$IfTl      70;%L2  t0[! [! [! [! [! [! %644 l` apyt0tTd e   q_M;M-hhw5OJQJ^J#hh*!95CJOJQJ^JaJ#hhw5CJOJQJ^JaJ#hh!5CJOJQJ^JaJ-h*!96B*CJ,OJQJaJ,mHnHph[!u-hw6B*CJ,OJQJaJ,mHnHph[!uh8h.h.5B* CJOJPJQJ^JaJnH ph^tH he#hHhR <5CJOJQJ^JaJh95CJOJQJ^JaJhhR <5OJQJ^JhhR <OJQJ^J ]XGXXXX$ B#U]Ua$gd.gdkd $$IfTl      70;%L2  t0[! [! [! [! [! [! %644 l` apyt0tT     ( * ja $IfgdX'kd $$Ifl0&% t0%644 layt $$Ifa$gd $Ifgdct  ' ( ) * + T U V W X Y Z [ | } ~  o^M< h"'h6CJ OJQJ^JaJ h"'hwRCJOJQJ^JaJ h"'hSs CJOJQJ^JaJ h"'hujCJ OJQJ^JaJ h"'huKCJOJQJ^JaJh"'ha|OJQJ^J h"'hujCJOJQJ^JaJ h"'ha|CJOJQJ^JaJh"'hG7OJQJ^J h"'hZWCJOJQJ^JaJ h"'h*!9CJOJQJ^JaJ h"'hG7CJOJQJ^JaJ* + . T V l`W` $IfgdX' $$Ifa$gdkd: $$IflTF&% t0%6    44 laytV W Z [ }  l`TK?6 $Ifgd"' $$Ifa$gd9 $Ifgd9 $$Ifa$gd"' $$Ifa$gdkd $$IflTF&% t0%6    44 layt l`TKB`T $Ifgd"' $Ifgd*] $$Ifa$gd"' $$Ifa$gdkdn $$IflTF&% t0%6    44 layt   ! " # $ % & O Q R S T ѯээрѯo^ooэр h"'hujCJOJQJ^JaJ h"'hIsCJOJQJ^JaJh"'hujOJQJ^J h"'h[CJOJQJ^JaJ h"'h$pgCJOJQJ^JaJ h"'h6CJOJQJ^JaJ h"'hiCJOJQJ^JaJ h"'hujCJOJQJ^JaJ h"'h_QCJOJQJ^JaJh"'huKOJQJ^J! l`W` $Ifgd*] $$Ifa$gdkd$$IflTF&% t0%6    44 layt ! # l`WNWB $$Ifa$gd"' $IfgdIs $Ifgd"' $$Ifa$gdkd$$IflTF&% t0%6    44 layt# $ ' O R l`W` $Ifgd! $$Ifa$gdkd<$$IflTF&% t0%6    44 laytR S V ^ a l`W` $Ifgd! $$Ifa$gdkd$$IflTF&% t0%6    44 laytT ^ _ ` a b c s | |͞o^|͞oP?P? h"'h9CJOJQJ^JaJh9CJOJQJ^JaJ h"'h4CJOJQJ^JaJh"'hujOJQJ^J h"'hIsCJOJQJ^JaJ h"'h6CJOJQJ^JaJ h"'hujCJOJQJ^JaJ h"'h_QCJOJQJ^JaJh"'h7OJQJ^J h"'h[CJOJQJ^JaJ h"'h$pgCJOJQJ^JaJ h"'h7CJOJQJ^JaJa b e l`W` $Ifgd! $$Ifa$gdkdp$$IflTF&% t0%6    44 layt l`W` $Ifgdct $$Ifa$gdkd $$IflTF&% t0%6    44 layt l`W` $Ifgdct $$Ifa$gdkd$$IflTF&% t0%6    44 layt  C D M N l m n o p Ǽ||kZIk<h"'h-~_OJQJ^J h"'h[CJOJQJ^JaJ h"'hS$CJOJQJ^JaJ h"'h-~_CJOJQJ^JaJh"'hOOJQJ^J h"'hdCJOJQJ^JaJ h"'hOCJOJQJ^JaJ h"'hOCJOJQJ^JaJh"'hwCJaJh"'h*!9OJQJ^Jh"'h9OJQJ^J h"'h9CJOJQJ^JaJh9CJOJQJ^JaJ l`W` $Ifgdct $$Ifa$gdkd>$$IflTF&% t0%6    44 layt  C D M lgg^^^^R $$Ifa$gd $IfgdKgdwkd$$IflTF&% t0%6    44 laytM N Q l o vmv $IfgdK $$Ifa$gd}kdr$$Ifl\0&% t0%644 layto p s ocZc $IfgdK $$Ifa$gdkd$$IflTF&%d t0%6    44 laytp y 24567nNr`#hh-~_5CJOJQJ^JaJhh-~_OJQJ^J hh*!9CJOJQJ^JaJ hh-~_CJOJQJ^JaJh"'h-~_OJQJ^Jh9CJOJQJ^JaJ h"'h}MCJOJQJ^JaJ h"'h*!9CJOJQJ^JaJ h"'hdCJOJQJ^JaJ h"'h-~_CJOJQJ^JaJ% ocZc $IfgdK $$Ifa$gdkd$$IflTF&%d t0%6    44 layt 36ocZc $IfgdK $$Ifa$gdkd#$$IflTF&%d t0%6    44 layt67:ocZc $IfgdK $$Ifa$gdkd$$IflTF&%d t0%6    44 laytocZc $IfgdK $$Ifa$gdkdM$$IflTF&%d t0%6    44 laytocZc $IfgdK $$Ifa$gdkd$$IflTF&%d t0%6    44 layt !"&)6ì{`O?/h.hG75OJQJ^JaJh.hX'5OJQJ^JaJ h\5>*CJOJQJ^JaJ4jh\5>*CJOJQJU^JaJmHnHu3h0h06B*CJOJQJaJmHnHph[!u-hL6B*CJ,OJQJaJ,mHnHph[!u-hC}6B*CJ,OJQJaJ,mHnHph[!uhh-~_OJQJ^J hh-~_CJOJQJ^JaJh9CJOJQJ^JaJ hhIsCJOJQJ^JaJ !#$%&6ojjjjjjjegd.gdkdw$$IflTF&%d t0%6    44 layt 6@DJKN GHIO´ӴӴykZ he1huKCJOJQJ^JaJh1ECJOJQJ^JaJh# CJOJQJ^JaJh1CJOJQJ^JaJ he1h1CJOJQJ^JaJh.CJOJQJ^JaJh0CJOJQJ^JaJ hzhzCJ OJQJ^JaJ he1CJOJQJ^JaJhuKCJOJQJ^JaJ he1he1CJOJQJ^JaJ#6Ibc#^gd"' ;^`;gd"' ;^`;gd. ^`gd0 ;^`;gd.gdz & F;^`;gd.bcgijl  &3|ӷөӛӷ}lZlLlLlLlh1CJOJQJ^JaJ#h5AAha|5CJOJQJ^JaJ h5AAha|CJOJQJ^JaJha|CJOJQJ^JaJh.ha|5OJQJ^JaJhpCJOJQJ^JaJh CJOJQJ^JaJ hG7huKCJOJQJ^JaJhuK5OJQJ^JhuKCJOJQJ^JaJ he1huKCJOJQJ^JaJh1ECJOJQJ^JaJ$7abgp"#(~~m_m_mN>h.ha|5OJQJ^JaJ ha|ha|CJOJQJ^JaJh.CJOJQJ^JaJ h nh1CJOJQJ^JaJ"hUz9CJOJQJ^JaJmH sH (ha|hUz9CJOJQJ^JaJmH sH hUz9CJOJQJ^JaJh1CJOJQJ^JaJ#h5AAha|5CJOJQJ^JaJha|CJOJQJ^JaJ h5AAha|CJOJQJ^JaJh# CJOJQJ^JaJ#$;`&II^gdOi< 0^`0gd1EgdOi<8^8gdOi< & Fgd & Fgd. & Fgd"'gd"' ;^`;gd"'.7:;<>`%&HInpseWE# *hI'-hOi<CJOJQJ^JaJhUz9CJOJQJ^JaJhFGCJOJQJ^JaJh CJOJQJ^JaJhFGCJ OJQJ^JaJ hOi<CJOJQJ^JaJ h1EhOi<CJOJQJ^JaJ#h1EhOi<5CJOJQJ^JaJ h1EhSs CJOJQJ^JaJha|CJOJQJ^JaJh.hOi<5OJQJ^JaJh.hSs 5OJQJ^JaJE!HIͻo^L:#hhOi<5CJOJQJ^JaJ#hhwR5CJOJQJ^JaJ hh1ECJOJQJ^JaJ hha|CJOJQJ^JaJh1ECJOJQJ^JaJh?CJOJQJ^JaJh,CJOJQJ^JaJ h1EhOi<CJOJQJ^JaJ#h1EhOi<5CJOJQJ^JaJ h1Eh1ECJOJQJ^JaJha|CJOJQJ^JaJ& *hI'-hOi<5CJOJQJ^JaJIQR:| } ~ б~~l^PB1 h7Fh(rCJOJQJ^JaJh(rCJOJQJ^JaJh1ECJOJQJ^JaJha|CJOJQJ^JaJ# *h&2hOi<CJOJQJ^JaJ hh&2CJOJQJ^JaJ hhOi<CJOJQJ^JaJ h.hOi<CJOJQJ^JaJ h.h=[CJOJQJ^JaJh.CJOJQJ^JaJ h.h1CJOJQJ^JaJh1CJOJQJ^JaJ hhOi<CJOJQJ^JaJ R | } !!"""## 0^`0gd. & Fgd.B^Bgd. & F`gd.h^hgd(r 0^`0gd1E^gd&2 & F1`1gd.^gdOi< & F;^`;gd. 7!V!z!!!"""##q#####"$#$$$'$$$±ӣseWI;h0CJOJQJ^JaJh1ECJOJQJ^JaJha|CJOJQJ^JaJhzCJOJQJ^JaJhUz9CJOJQJ^JaJ h0h0CJOJQJ^JaJ h0h(rCJOJQJ^JaJh.CJOJQJ^JaJ ht>h(rCJOJQJ^JaJ h7Fh.CJOJQJ^JaJh(rCJOJQJ^JaJ h7Fh(rCJOJQJ^JaJh?CJOJQJ^JaJ#"$#$$$$$\&]& ''''M*N*++,, ;^`;gd9$;^`;a$gd.^gd. ;^`;gd. & Fgd. & FgdFGgd(r 0^`0gd1E 0^`0gd.$$$$,%-%Q%R%U%t%%%%%\&]&' ''''''''''±±£±’„ssesesesWF hFGh(rCJOJQJ^JaJha|CJOJQJ^JaJh.CJOJQJ^JaJ hd!h(rCJOJQJ^JaJhzCJOJQJ^JaJ h.h.CJOJQJ^JaJh"'CJOJQJ^JaJ h.ha|CJOJQJ^JaJ h.h(rCJOJQJ^JaJhFGCJOJQJ^JaJh(rCJOJQJ^JaJ h1Eh(rCJOJQJ^JaJ''''''(((()))))))) **9*;*K*L*M*R*p*s*++;ͭͭuddVhHCJOJQJ^JaJ ha|hHCJOJQJ^JaJhOi<CJOJQJ^JaJha|CJOJQJ^JaJh CJOJQJ^JaJh.CJOJQJ^JaJ ha|hOi<CJOJQJ^JaJha|5CJOJQJ^JaJ#ha|hOi<5CJOJQJ^JaJ ha|ha|CJOJQJ^JaJh(r5CJOJQJ^JaJ+++,,,,),H,I,J,L,M,,,,,,----ƶxkZLZLZL;LZ h3Jh CJOJQJ^JaJh CJOJQJ^JaJ h60Uh CJOJQJ^JaJh nh.OJQJ^Jh9h nCJOJQJ^Jh9hFGCJOJQJ^Jh.h.5OJQJ^JaJh.h.5OJQJ^JaJh.h n5OJQJ^JaJh.hFG5OJQJ^JaJ *h(rh(rOJQJ^Jha|CJOJQJ^JaJhSs CJOJQJ^JaJ,I,Z.[.\.].^._.`.a.b.c.d.e.f.g.h.i.j.k.l.m.n.o.p.q.$a$gd. ;^`;gd9 ;^`;gd.--(.0.Y.[.t............ / /ŷ}n\}J};}hnz5CJOJQJ^JaJ#hnzhi5CJ OJQJ^JaJ #h nh#5CJOJQJ^JaJhJ5CJOJQJ^JaJhi5CJOJQJ^JaJhz5CJOJQJ^JaJhG7CJOJQJ^JaJh}-CJOJQJ^JaJh/?/c/d/////////////////////gd $`a$gdigdX'///////////////////000000"gd.T 7$8$H$^gd.T & F-7$8$H$gd.T 7$8$H$gdgdX'///0000000011111'191:1V1W1˺}iUGhCJOJQJ^JaJ&hh.T5CJOJQJ\^JaJ&hh5CJOJQJ\^JaJhh5OJQJ^Jhh.TOJQJ^J hhCJOJQJ^JaJ hh.TCJOJQJ^JaJ hh.TCJOJQJ^JaJhh5OJQJ^Jhh.T5OJQJ^Jh5OJQJ^JhCJOJQJ^JaJ011W1X111111111112233gdj` ;^`;gd.$;^`;a$gd.gdX' 7$8$H$gd"gd 7$8$H$^gd & F/7$8$H$gd.T 7$8$H$gd 7$8$H$gd.TW1X1d1k1111111111111111޿ͱscSC5hFGCJOJQJ^JaJh.hX'5OJQJ^JaJh.h.5OJQJ^JaJh.huj5OJQJ^JaJh.h}-5OJQJ^JaJh.hFG5OJQJ^JaJhJ5CJOJQJ^JaJhi5CJOJQJ^JaJhCJOJQJ^JaJhCJOJQJ^JaJ hhCJOJQJ^JaJ hh.TCJOJQJ^JaJ hhCJOJQJ^JaJ111$292@2L2S2T2U2\2b2n22222222333tbP? hshj`CJOJQJ^JaJ#h*Ih*I5CJOJQJ^JaJ#h nh*I5CJOJQJ^JaJh nCJOJQJ^JaJhFGCJOJQJ^JaJh.CJOJQJ^JaJ h nhCJOJQJ^JaJ h nh1YCJOJQJ^JaJ h nh*ICJOJQJ^JaJ h nhX'CJOJQJ^JaJh nhX'OJQJ^J hg}h nCJOJQJ^JaJ333K3a3r3{333333333|$-D@&IfM ]gd$-D@&IfM ]^gd'W & F)$-D@&IfM ]gd'W & F $-D@&IfM ]gdh$-D@&IfM ]^hgd333+3,3K3`333333333333ɺɩɍ{j\K: hh\pCJOJQJ^JaJ h'WhVOACJOJQJ^JaJh! CJOJQJ^JaJ hhVOACJOJQJ^JaJ#hhVOA5CJOJQJ^JaJh CJOJQJ^JaJh'WCJOJQJ^JaJ h'Wh'WCJOJQJ^JaJh85CJOJQJ^JaJh'W5CJOJQJ^JaJ#hh5CJOJQJ^JaJ)hhj`B*CJOJQJ^JaJphMMM333J4K4t4u4445 5N5v$@&If]gd'W "$Ifgdac1 "$Ifgd8h$-D@&IfM ]^hgd\p$-D@&IfM ]^gd8 & F $-D@&IfM ]gd\p$-D@&IfM ]gd 333K4s4t4u4x44444445 5 5ύn`N@/ h8h8CJOJQJ^JaJh! CJOJQJ^JaJ#h8h85CJOJQJ^JaJh8CJOJQJ^JaJ h8h\pCJOJQJ^JaJh2CJOJQJ^JaJ#hhj`5CJOJQJ^JaJ#h\ph\p5CJOJQJ^JaJh\p5CJOJQJ^JaJh'W5CJOJQJ^JaJh85CJOJQJ^JaJ hhj`CJOJQJ^JaJ hhCJOJQJ^JaJ 5N5O5P5Q5R5S5r5~555"6#6$6%6'66˹ucucuUG9Uhg}CJOJQJ^JaJhFGCJOJQJ^JaJhj`CJOJQJ^JaJ#hh5CJOJQJ^JaJ#hhj`5CJOJQJ^JaJh1Y5CJOJQJ^JaJ#h! h\p5CJOJQJ^JaJ hshj`CJOJQJ^JaJ#hhj`5CJOJQJ^JaJ#hhj`5CJOJQJ^JaJ#h! hp5CJOJQJ^JaJ h8h! CJOJQJ^JaJN5O5P5Q5R5S5#6$6778zulll___ ;^`;gd.^gdj`gdX'lkd $$IflU%" t0644 la<yt\p $IfgdE|$@&If]gdp 6677778888888999ȷxhXHhH6#hg}hX'5CJOJQJ^JaJh.h65OJQJ^JaJh.hX'5OJQJ^JaJh.huj5OJQJ^JaJh.hFG5OJQJ^JaJh.5CJOJQJ^JaJh'W5CJOJQJ^JaJ hg}h1YCJOJQJ^JaJ hg}hg}CJOJQJ^JaJhFGCJOJQJ^JaJh1YCJOJQJ^JaJhj`CJOJQJ^JaJh.CJOJQJ^JaJ8888889k9l9999999999999 $`a$gdngd"Uigd  gd  $@&a$gd  $`a$gd  $@&a$gdB`gd gdX'9I9j9k9l9m9n9o999999999ĴteWH7 h h CJOJQJ^JaJhs5CJOJQJ^JaJjh JUmHnHuh9hBCJOJQJ^Jh9hN5CJOJQJ^Jh9h**5CJOJQJ^Jh9hP[_5CJOJQJ^Jh9hB5CJOJQJ^Jh9h.5CJOJQJ^J#h.h.5CJOJQJ^JaJh 5OJQJ^Jh CJOJQJ^JaJ hg}h CJOJQJ^JaJ9999999999999999999خؕp^O:/h J5OJQJ^J)jhn5OJQJU^JmHnHuh 5CJOJQJ^JaJ#hg}hn5CJOJQJ^JaJh75CJOJQJ^JaJhIk5OJQJ^Jhr@5OJQJ^Jh h 5OJQJ^Jh 5OJQJ^J)jh 5OJQJU^JmHnHu hch CJOJQJ^JaJh )jh J5OJQJU^JmHnHu#h#h 5CJOJQJ^JaJ9999999999999999999999999: $`a$gdmfkgd"Ui $`a$gd 999::::#:$:%:&:':(:E::ȶzi[I7& hg}h`LCJOJQJ^JaJ#hg}hX'5CJOJQJ^JaJ#hg}h"Ui5CJOJQJ^JaJh7CJOJQJ^JaJ hg}hg}CJOJQJ^JaJhFGCJOJQJ^JaJh**CJOJQJ^JaJhs5OJQJ^J)jh}|5OJQJU^JmHnHu#h**h}|5CJOJQJ^JaJhmfk5CJOJQJ^JaJ#hg}hmfk5CJOJQJ^JaJh}|5OJQJ^Jhr@5OJQJ^J:::::::::: :!:":#:$:E::7;8;<<2=3==$;^`;a$gd. $^a$gd. ;^`;gd.gd"Ui$a$gd}|::::;8;9;;;<;=;t;;<<<<<<<<2=3=4=6=7=D==´ЕveW´vvF´Fv hr@hr@CJOJQJ^JaJh}CJOJQJ^JaJ h?fhr@CJOJQJ^JaJhr@CJOJQJ^JaJ h9hr@CJOJQJ^JaJ hg}hr@CJOJQJ^JaJhg}CJOJQJ^JaJh7CJOJQJ^JaJhFGCJOJQJ^JaJ hg}h`LCJOJQJ^JaJ hg}h[ CJOJQJ^JaJh9CJOJQJ^JaJ============== > >>Ŷu]uEu]u6ha5CJOJQJ^JaJ/hh}56B*CJOJQJ^JaJph33/hh}56B*CJOJQJ^JaJph33#hh}5CJOJQJ^JaJ#h}h}5CJOJQJ^JaJhr@5OJQJ^J#h}h}5CJOJQJ^JaJh}5CJOJQJ^JaJ hg}h}CJOJQJ^JaJh8CJOJQJ^JaJhr@CJOJQJ^JaJh`LCJOJQJ^JaJ==========]kd$$Ifl0%  t0"644 la<yt $@&Ifgd $@&a$gd}^gdr@gdg} === >eZZ $@&Ifgdkd.$$Ifl0%  t0"644 la<pyt > >>)>tt $@&Ifgdkd$$Ifl%0% t0"644 la<yt>>)>*>8>B>C>V>W>a>g>u>>>>>?'?G?I?W?Y?Z?m?????@@@"@,@C@M@j@t@ëÜëëëëÈt\ëëë\ëëë/hh}56B*CJOJQJ^JaJph33&hh`L56CJOJQJ^JaJ&hh}56CJOJQJ^JaJhD5CJOJQJ^JaJ/hh}56B*CJOJQJ^JaJph33#hh}5CJOJQJ^JaJ/hha56B*CJOJQJ^JaJph33#hha5CJOJQJ^JaJ$)>*>8>B>tt $@&Ifgdkd$$Ifl%0% t0"644 la<ytB>C>W>a>tt $@&Ifgdkd$$Ifl]0% t0"644 la<yta>b>g>u>tt $@&Ifgdkd$$IflZ0% t0"644 la<ytu>v>>>tt $@&Ifgdkd8$$Iflq0% t0"644 la<yt>>>>tt $@&Ifgdkd$$IflQ0%  t0"644 la<yt>>I?W?tt $@&Ifgdkdh$$Ifl\0%  t0"644 la<ytW?X?Y?Z?tt $@&Ifgdkd$$Ifl0%  t0"644 la<ytZ?[?m??eZZ $@&Ifgdkd$$Ifl0%  t0"644 la<pyt????tt $@&Ifgdkdl$$Ifl@0% t0"644 la<yt???@tt $@&Ifgdkd$$Iflo0% t0"644 la<yt@@@@tt $@&Ifgdkd $$IflM0%  t0"644 la<yt@@"@,@eZZ $@&Ifgdkd-!$$Ifl0%  t0"644 la<pyt,@-@C@M@tt $@&Ifgdkd!$$IflL0% t0"644 la<ytM@N@j@t@tt $@&Ifgdkd"$$IflU0% t0"644 la<ytt@u@@@tt $@&Ifgdkd#$$Ifl0% t0"644 la<ytt@u@@@@@@AAAAAA@AAAVBXBYB|B۴۰qcqR@q#h?fhX'5CJOJQJ^JaJ h #hX'CJOJQJ^JaJh`LCJOJQJ^JaJ h?fhX'CJOJQJ^JaJ#h*!9hX'5CJOJQJ^JaJh7CJOJQJ^JaJhFGCJOJQJ^JaJhDhD5CJOJQJ^JaJ/hhD56B*CJOJQJ^JaJph33#hhD5CJOJQJ^JaJ#hh}5CJOJQJ^JaJ@@@Ati $@&Ifgd $@&IfgdDkd#$$Ifl0% t0"644 la<ytAAAA@A$C%CMCEEGzuulgZZZZ ;^`;gd.gdX'^gdX'gd"Ui#gdDkd7$$$Ifl0% t0"644 la<yt |BBBBB#C$C%C&C(CBCKCLCMCNCQC~DDDDDDEE0E?EEEǵtfUGUGUGUGUGUGh&2CJOJQJ^JaJ h5AAh&2CJOJQJ^JaJhg}CJOJQJ^JaJhFGCJOJQJ^JaJ#hg}hd5CJOJQJ^JaJ#hg}hX'5CJOJQJ^JaJh"'5CJOJQJ^JaJ#h*!9hX'5CJOJQJ^JaJhFG5CJOJQJ^JaJhX'5OJQJ^J h hX'CJOJQJ^JaJhX'CJOJQJ^JaJEFFFgGGGGGGHHHH H!H"H$H&H'H*H-H.H/H0H°}n`\`\N\@N\@N\jh_3UmHnHujh2UmHnHuh2jhw UmHnHuh25CJOJQJ^JaJh"'5CJOJQJ^JaJ#h2h25CJOJQJ^JaJ#h2h25CJOJQJ^JaJ#h2h25CJOJQJ^JaJh2CJOJQJ^JaJh.CJOJQJ^JaJ hg}h`LCJOJQJ^JaJ hg}h2CJOJQJ^JaJGGGHHHHHHH H"H%H&H+H,H-H0H2H4H5H6H7H8H9H:H $IfgdK$;^`;a$gd"'^gd20H1H2H3H;HH?H@HAHXHYHZH[H\H^H_HaHbHcHdHeHfHgHGIWIIIIྭm[mIm#h\hP:5CJOJQJ^JaJ#h\h\5CJOJQJ^JaJ#h\h5CJOJQJ^JaJhz5CJOJQJ^JaJhzCJOJQJ^JaJ hh_3CJOJQJ^JaJ hhw CJOJQJ^JaJ#hh25CJOJQJ^JaJj$h0Ujh2Ujh_3UmHnHuh2jh2UmHnHu:H;H=H>H@H]H^H`HaHcHfHVIII $@&Ifgd&2 $@&Ifgd\m$ $@&Ifgd $$@&Ifa$gd $IfgdK IIIIIII\J]JKKKKDLELLLLLLMMM.NTNUN^NkNuNvNNN OjOlO²tftftftftftftfhI3CJOJQJ^JaJ h5AAhI3CJOJQJ^JaJh.CJOJQJ^JaJ h nh;CCJOJQJ^JaJhFGCJOJQJ^JaJh"'h;C5OJQJ^JaJ h"'5OJQJ^JaJ h"'h"'5OJQJ^JaJ hh25OJQJ^J#hh&25CJOJQJ^JaJ"IIIKKLLlOmOOPPuuuuuuu ;^`;gd.;@&^`;gd.gd;CjkdX%$$Iflc$% t0%644 laytz lOmOOOOOOOPPPPPPPPPPPPPwffUGh0CJOJQJ^JaJ hg}h-CJOJQJ^JaJ h-h-CJOJQJ^JaJh"'CJOJQJ^JaJh-CJOJQJ^JaJh>bCJOJQJ^JaJ hJ~bh>bCJOJQJ^JaJhg}5CJ OJQJ^JaJ hg}hg}CJOJQJ^JaJhFGCJOJQJ^JaJ"h"'h"'5;OJQJ^JaJh;CCJOJQJ^JaJPPPQR!T"TTTTTTTT+UdUUUUV V!V $@&a$gd>b $K`Ka$gd$gdg}gd>b 0^`0gdFGgd- & F;^`;gd.P&Q=Q>QQQQRRRRUSySS T!T"T#T$T&TtTzT{TTTTTŷyk]OkO]]hOCJOJQJ^JaJh>bCJOJQJ^JaJhg}CJOJQJ^JaJh7CJOJQJ^JaJh_3CJOJQJ^JaJ h"'h-CJOJQJ^JaJ hh-CJOJQJ^JaJh"'CJOJQJ^JaJh@CJOJQJ^JaJhFGCJOJQJ^JaJh-CJOJQJ^JaJ h&l;h-CJOJQJ^JaJTTTTTTTTTTTTU*U+UbUdUUUUUUոweVeVeVeVeE7h>bCJOJQJ^JaJ h=h>bCJOJQJ^JaJh>b5CJOJQJ^JaJ#h=h>b5CJOJQJ^JaJ#hY-h>b5CJOJQJ^JaJjh>bUmHnHu#h>bh_35CJOJQJ^JaJh-5CJOJQJ^JaJh>b5CJOJQJ^JaJh9CJOJQJ^JaJh7CJOJQJ^JaJ h$h>bCJ OJQJ^JaJ h>b5OJQJ^JUUUVVVVVV!V}V~VVVVVVVVVVVVVWگhگVGVh>b6CJOJQJ^JaJ#h=h>b6CJOJQJ^JaJ/j&h=h>bCJOJQJU^JaJh>bCJOJQJ^JaJ#h=h>b5CJOJQJ^JaJh>b5CJOJQJ^JaJ$h=h>b0JCJOJQJ^JaJ/j%h=h>bCJOJQJU^JaJ)jh=h>bCJOJQJU^JaJ h=h>bCJOJQJ^JaJ!VOVVVVWWWWWWWWWWWWWWWWW W!W"W#W$a$gd>bgd>b $@&a$gd>b $h^ha$gd>bWWW%WcWdWWWWWWWWWWWϽޜ~o`QB3h"'5CJOJQJ^JaJh95CJOJQJ^JaJh]5CJOJQJ^JaJh5CJOJQJ^JaJh$5CJOJQJ^JaJh-5CJOJQJ^JaJh>b5CJOJQJ^JaJ#h`#h>b5CJOJQJ^JaJh>b5CJOJQJ^JaJ#h[h>b5CJOJQJ^JaJhB"5CJOJQJ^JaJh>b5CJOJQJ^JaJ#h$h>b5CJ OJQJ^JaJ #W$W%WdWWWWWWWWWWWWWWWWWWWWWW$a$gd@$a$gd$$a$gd>b $K`Ka$gd>b$a$gd>bWWWWWWWWXXXXXXXȹzjYH:H/hg}5OJQJ^JhFGCJOJQJ^JaJ hg}hg}CJOJQJ^JaJ hg}hZWCJOJQJ^JaJh9hZW5OJQJ^JaJh9h95OJQJ^JaJh9hFG5OJQJ^JaJh9huj5OJQJ^JaJh\p5CJOJQJ^JaJh5CJOJQJ^JaJhB"5CJOJQJ^JaJh 5CJOJQJ^JaJ1jh\p5CJOJQJU^JaJmHnHuWWWWWWWWWWWWWWWWWWWWWWXXXXX $IfgdK^gdOgdg}gdX'X`XaXjXXXXXXXXXXXYYYYYYOYPYQYZY[Y\YYYYñ}}l[J[}}[J[}}[J[ h\ph4CJOJQJ^JaJ hh4CJOJQJ^JaJ hhdCJOJQJ^JaJ#hh45CJOJQJ^JaJ h\phCJOJQJ^JaJ hhCJOJQJ^JaJ#hh5CJOJQJ^JaJh4OJQJ^J h@h4CJOJQJ^JaJ h@hg}CJOJQJ^JaJ h@hOCJOJQJ^JaJXXXXXYYy}kd'$$Ifl0v "= t0644 laHyt $IfgdKYYYOYPYyyy $IfgdK}kd($$Ifl0v "= t0644 laHytPYQY\YYYyyy $IfgdK}kd($$Ifl0v "= t0644 laHytYYYYYyyy $IfgdK}kd3)$$Ifl0v "= t0644 laHytYYYYYYYZZZ>Z?Z@ZIZJZKZZZZZZZZZZZZZ[ʹʹʮshWIh@CJOJQJ^JaJ h@h@CJOJQJ^JaJh@5OJQJ^Jh9hX'5;OJQJ^Jh9h@5;OJQJ^Jh9hFG5;OJQJ^JhX'5OJQJ^JhO5OJQJ^J h\ph4CJOJQJ^JaJ hh4CJOJQJ^JaJ#hh5CJOJQJ^JaJ#hh45CJOJQJ^JaJYYZ>Z?Zyyy $IfgdK}kd)$$Ifl0v "= t0644 laHyt?Z@ZKZZZyyy $IfgdK}kdK*$$Ifl0v "= t0644 laHytZZZZ[[\[w[\\\\ytttthtc[$a$gdHgd9 $^a$gd\pgdX'^gdO}kd*$$Ifl0v "= t0644 laHyt Z[[[\[^[w[y\z\\\\\\\\\\\\odYNC5hHh\m5OJQJ^JhH5OJQJ^Jhc5OJQJ^Jh95OJQJ^Jh5OJQJ^J$h5AAh\p0JCJOJQJ^JaJ/jc+h5AAh\pCJOJQJU^JaJ)jh5AAh\pCJOJQJU^JaJ h5AAh\pCJOJQJ^JaJh9h@5;OJQJ^Jh9hFG5;OJQJ^J#h9h@;CJOJQJ^JaJhCJOJQJ^JaJ\\\\]]]]] ] ] ] ] ]]]]]]]]]]]]]]]]gdct$a$gdct\\\\]]]] ] ] ]]ǵ{lZF2&h-e5B*CJOJQJ^JaJphMMM&hct5B*CJOJQJ^JaJphMMM#hhjp5CJOJQJ^JaJhjp5CJOJQJ^JaJ1jhjp5CJOJQJU^JaJmHnHuhct5CJOJQJ^JaJ#hhap5CJOJQJ^JaJ#hhct5CJOJQJ^JaJhJVf5CJOJQJ^JaJ,h~h-e5B*CJOJQJ^JaJphMMM#h+hct5CJOJQJ^JaJ ]]]]]!]$]'](]*]+]>]@]C]D]E]F]J]η΅l]N:&h'5B*CJOJQJ^JaJphMMMh95CJ OJQJ^JaJ hL`5CJ OJQJ^JaJ 1jhJVf5CJ OJQJU^JaJ mHnHu&hc5B*CJOJQJ^JaJphMMMh-e5CJ OJQJ^JaJ hct5CJ OJQJ^JaJ ,heyh-e5B*CJOJQJ^JaJphMMM&h-e5B*CJOJQJ^JaJphMMM:jhJVf5B*CJOJQJU^JaJmHnHphMMMu]]] ]!]"]#]$]%]&]'])]*]+],]-].]/]0]1]2]3]4]5]6]7]8]9]:]gd-egdct:];]<]=]>]?]@]A]B]C]E]G]H]I]J]K]L]M]N]O]Q]R]S]T]U]V]W]X]Y]gd~gd-egdctJ]O]P]Y][]c]n]q]v]w]]]]]]]]]ȴ{c{U{GcG9GhJVfCJOJQJ^JaJh}CJOJQJ^JaJh+CJOJQJ^JaJ.jhJVfCJOJQJU^JaJmHnHuh~CJOJQJ^JaJh&VCJOJQJ^JaJhctCJOJQJ^JaJh-e5CJ OJQJ^JaJ &h~5B*CJOJQJ^JaJphMMMh~5CJ OJQJ^JaJ 1jhJVf5CJ OJQJU^JaJ mHnHuha'5CJ OJQJ^JaJ Y]Z][]\]]]^]_]`]a]b]c]d]e]f]g]h]i]j]k]l]m]n]o]p]q]r]s]t]u]gdctgd-egd~u]v]x]y]z]{]|]}]~]]]]]]]]]]]]]]]]]]]]]]gdct]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]gdct]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]gdct]]]]]]]]]]]]]]] ^̾k]N?-#hhct5CJOJQJ^JaJh95CJOJQJ^JaJhct5CJOJQJ^JaJh&VCJOJQJ^JaJ,heyhVt5B*CJOJQJ^JaJphMMM&hVt5B*CJOJQJ^JaJphMMM1jhB@~5CJ OJQJU^JaJ mHnHuhVt5CJ OJQJ^JaJ h~CJOJQJ^JaJh}CJOJQJ^JaJ.jhB@~CJOJQJU^JaJmHnHuh9CJOJQJ^JaJ]]]]]]]]]]]]]]]]]]]]]]]]]]]]]gdVtgdct]]]]]]]]] ^^^^^^^^^^^^^^^^ ^!^"^#^gdctgdVt ^ ^ ^^^^^^'^(^.^/^8^A^B^G^S^T^f^ȹȹȪȪs[M?[?hB@~CJOJQJ^JaJh`CJOJQJ^JaJ.jhB@~CJOJQJU^JaJmHnHuh`5CJOJQJ^JaJh95CJOJQJ^JaJ1jh95CJOJQJU^JaJmHnHuhVt5CJOJQJ^JaJhB@~5CJOJQJ^JaJ1jhB@~5CJOJQJU^JaJmHnHuhct5CJOJQJ^JaJhap5CJOJQJ^JaJ#^$^%^&^'^)^*^+^,^-^0^1^2^3^4^5^6^7^8^9^:^;^<^=^>^?^@^A^C^gd`gdVtgdctC^D^E^F^G^H^I^J^K^L^M^N^O^P^Q^R^S^U^V^W^X^Y^Z^[^\^]^^^_^`^a^gd`a^b^c^d^e^f^h^i^j^k^l^m^n^o^p^q^r^s^t^u^v^w^x^y^z^{^}^~^^^gd`f^g^z^{^|^}^^^^^^^^^^^^^^^^˲ˎˎyˎj[LhB@~5CJOJQJ^JaJhd5CJOJQJ^JaJhd5CJOJQJ^JaJ)h95>*B*CJOJQJ^JaJph333)h`5>*B*CJOJQJ^JaJph333hY5CJOJQJ^JaJ1jhd5CJOJQJU^JaJmHnHuh`5CJOJQJ^JaJh`CJOJQJ^JaJ.jhdCJOJQJU^JaJmHnHu^^^^^^^^^^^^^^^^^^^^^^^^^-DM [$\$gdct-DM [$\$gd`gd`^^^^^^^^^^^^^^^^^^^^^^^^^^^gdct-DM [$\$gd`gd`^^^^^^^^^^^^^ _ _ų||dRC5'h9CJOJQJ^JaJhCJOJQJ^JaJh~i5CJOJQJ^JaJ#hhd5CJOJQJ^JaJ.jhdCJOJQJU^JaJmHnHuhd5CJOJQJ^JaJ1jhd5CJOJQJU^JaJmHnHuhct5CJOJQJ^JaJ#hhap5CJOJQJ^JaJ#hhct5CJOJQJ^JaJhB@~5CJOJQJ^JaJ1jhd5CJOJQJU^JaJmHnHu^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^gdct^^^^^^^^^^^^^^^_________ _ _ _ __gdgdct _ ___!_"_&_'_(_)_*_._/_1_2_3_7_=_>_?_@_˼˭˅l˭]N<#hoYlhA$5CJOJQJ^JaJhA$5CJOJQJ^JaJhct5CJOJQJ^JaJ1jh95CJOJQJU^JaJmHnHuh25CJOJQJ^JaJ1jhd5CJOJQJU^JaJmHnHuh5CJOJQJ^JaJh5CJOJQJ^JaJh5CJOJQJ^JaJ.jhdCJOJQJU^JaJmHnHuhCJOJQJ^JaJ_________________ _!_"_#_$_%_&_'_)_*_+_,_gdctgd,_-_._/_0_1_2_4_5_6_7_8_9_:_;_<_=_>_?_@_A_B_C_D_E_F_G_H_gdA$$a$gdctgdctgd@_A_B_F_H_I_P_i_k_l_r_____ᴦp\H9hdY5CJOJQJ^JaJ&hif5B*CJOJQJ^JaJph33&hct5B*CJOJQJ^JaJph33hif5CJOJQJ^JaJ.jh9CJOJQJU^JaJmHnHuh95CJOJQJ^JaJhifCJOJQJ^JaJhA$5CJOJQJ^JaJhA$5CJOJQJ^JaJhA$5CJOJQJ^JaJhH5CJOJQJ^JaJhct5CJOJQJ^JaJH_I_J_K_L_M_N_O_P_Q_R_S_T_U_V_W_X_Y_Z_[_\_]_^___`_a_b_c_d_gdifgdctd_e_f_g_h_i_k_m_n_o_p_q_r_s_t_u_v_w_x_y_z_{_|_}_~_____gdctgdif_____________________________gddYgdct_________________̳wi[M;#h&Vhct5CJOJQJ^JaJhJVfhct5OJQJ^Jh^hct5OJQJ^Jh^hH5OJQJ^Jh95CJOJQJ^JaJhdY5CJOJQJ^JaJh5CJOJQJ^JaJhdY5CJOJQJ^JaJ1jh5CJOJQJU^JaJmHnHuhct5CJOJQJ^JaJ#hdYhap5CJOJQJ^JaJ#hdYhct5CJOJQJ^JaJ__________````aaaaaa}b~b c cOcPc & Fgd $dha$gdH$a$gd9gddYgdct__``````aaaaaaaaa|b}b~b c c cNcOcPc d d dodpdqddddddNeOePeeecfdfffᨖttt hhctCJOJQJ^JaJ hOhctCJOJQJ^JaJ#h*hct5CJOJQJ^JaJhct5OJQJ^JhOhct5OJQJ^J#hhct5CJOJQJ^JaJhlhct5OJQJ^JhctCJOJQJ^JaJ hhctCJOJQJ^JaJ-Pc d dpdqddddOePeeecfdfffffKhLhbhhhhhhgd9@&^`gdct@&gdctgdct & FgdffffJhKhLhbhhhhhhhhhhhhhhhh´r`R``RRA h'hSs CJOJQJ^JaJhSs CJOJQJ^JaJ#h hSs 5CJOJQJ^JaJ hg1hSs CJOJQJ^JaJ h hSs CJOJQJ^JaJ#h*!9hSs 5CJOJQJ^JaJhC}CJOJQJ^JaJhctCJOJQJ^JaJ hhctCJOJQJ^JaJhct5>*OJQJ^J&h*hct5>*CJOJQJ^JaJhct5OJQJ^JhhaibitiiiWjXjRkSkalblllmnnnnoop & Fgd9 & Fgd9h^hgd9 & Fgd9 @&`gd9@&gd9 @&^gd9gd9hbitiiiiiiiiiVjWjXjljjjjQkRkSkalbllmnnnnnoopppppppp2q3qqq-r.rArnrprqrrr,s6s7sϾϾϾϾϾϓhSs 5OJQJ^J#h9h\p5CJOJQJ^JaJhSs CJOJQJ^JaJ h,4hSs CJOJQJ^JaJhSs CJOJQJ^JaJ#h'hSs 5CJOJQJ^JaJ h}hSs CJOJQJ^JaJ6pp2q3qqq-r.rArprqrrr7sCsDssuuuugdct$a$gdH$a$gd9^gd9h^hgd9 & Fgd9 h@&`hgd9 & Fgd9gd97s8s9sCsDssuuuujvkvlv w!wŷseSB1B hUHhctCJOJQJ^JaJ hchctCJOJQJ^JaJ#hG4ghct5CJOJQJ^JaJhctCJOJQJ^JaJ#hchct5CJOJQJ^JaJ#h*hct5CJOJQJ^JaJh9hctCJ OJQJ^J hchctCJOJQJ^JaJhJVfhct5OJQJ^J h*hHCJOJQJ^JaJh^hH5OJQJ^Jh^h~5OJQJ^Jh9CJOJQJ^JaJukvlv w!wwwwwBxCx9y:ylymyyyzz{{{{t|u|||}h^hgdctgdct & Fgd!wwwwwx%xBxCxxxy8y9y:ylymysyyyzzzz{{{{||"|A|I|V|t|u||||||;}<}M}}}ޜЋЋЀhct5OJQJ^J h&hctCJOJQJ^JaJ#h&hct5CJOJQJ^JaJ#h*hct5CJOJQJ^JaJh9hct5CJOJQJ^JhctCJOJQJ^JaJ hchctCJOJQJ^JaJ hG4ghctCJOJQJ^JaJ-}}}}}}~~~~~~/0HQXb޻{fOf=fOfOfO"hvCJOJQJ^JaJmH sH ,hvhv0JCJOJQJ^JaJmH sH (hvhvCJOJQJ^JaJmH sH %hv5CJOJQJ^JaJmH sH hct5mH sH +hchct5CJOJQJ^JaJmH sH hctCJOJQJ^JaJ h&hctCJOJQJ^JaJ#h&hct5CJOJQJ^JaJhct5CJOJQJ^JaJ#hchct5CJOJQJ^JaJ}~1 gdct `gdvgdct&/01^}q`R`hvCJOJQJ^JaJ hchctCJOJQJ^JaJ(hchctCJOJQJ^JaJmH sH "hctCJOJQJ^JaJmH sH +hvhv5CJOJQJ^JaJmH sH "hvCJOJQJ^JaJmH sH (hvhvCJOJQJ^JaJmH sH ,hvhv0JCJOJQJ^JaJmH sH &hv0JCJOJQJ^JaJmH sH #'(23pqt͊ЊƸrZE3E3rZE3"hctCJOJQJ^JaJmH sH (hf;hctCJOJQJ^JaJmH sH .hnMhct5CJ OJQJ\^JaJ mH sH .h*hct5CJOJQJ\^JaJmH sH #h*hct5CJOJQJ^JaJhJVfhct5OJQJ^Jh^hct5OJQJ^Jh^hH5OJQJ^JhH5OJQJ^Jh95CJOJQJ^JaJhct5CJOJQJ^JaJ hvhctCJOJQJ^JaJ  !"#$%&'($a$gdHgdct(3pqn$ΊϊЊ2gd~ dd[$\$gdct@&gdctgdct$a$gdH$a$gdHЊ23]^~KLRShjллллpaRh*5CJOJQJ^JaJhct5CJOJQJ^JaJ(hnMhctCJOJQJ^JaJmH sH "hctCJOJQJ^JaJmH sH "h~CJOJQJ^JaJmH sH "hHCJOJQJ^JaJmH sH (hf;hctCJOJQJ^JaJmH sH .hnMhct5CJ OJQJ\^JaJ mH sH .h*hct5CJOJQJ\^JaJmH sH 23;M=^~֟LfSTU dd[$\$gdctgdct@&gdctUVWXYZ[\]^_`abcdefghijuvɢʢlm$a$gdH$a$gdHgdctjtuɢʢlmrstգ֣`aƯmXC1C1C1C1#hctB*CJOJQJ^JaJph)h9shctB*CJOJQJ^JaJph)hIhctB*CJOJQJ^JaJph)hct5B*CJOJQJ\^JaJph/h9shct5B*CJOJQJ\^JaJph)hIhctB*CJOJQJ^JaJph,h*hct5B*CJOJQJ^JaJphhct5CJOJQJ^JaJhJVfhct5OJQJ^Jh^hct5OJQJ^Jh^hH5OJQJ^Jmst֣ףabxZ`a [$\$gdcth[$\$^hgdct & F [$\$gd\$gdctgdcth^hgdct & Fgdgdct XwxZ_`aijԿԿԩ橿r^M?M?M?M?M?hctCJOJQJ^JaJ h9shctCJOJQJ^JaJ&hIhct5CJOJQJ\^JaJ hct5CJOJQJ\^JaJ&h9shct5CJOJQJ\^JaJ#h*hct5CJOJQJ^JaJ+hctB*CJOJQJ^JaJmH phsH )h9shctB*CJOJQJ^JaJph#hctB*CJOJQJ^JaJph1hYhctB*CJOJQJ^JaJmH phsH jkݩީTUVWXcdjk & Fgd$a$gdH$a$gdHgdct [$\$gdct & F [$\$gdީ)?TUVWXbcdijkvweTBT#h|uhct5CJOJQJ^JaJ h-lhctCJOJQJ^JaJ#h*hct5CJOJQJ^JaJhH5CJOJQJ^JaJh^hct5OJQJ^Jh^hH5OJQJ^Jh*5CJOJQJ^JaJh95CJOJQJ^JaJhct5CJOJQJ^JaJ#h9shct5CJOJQJ^JaJhctCJOJQJ^JaJ h9shctCJOJQJ^JaJ$'()ƮǮȮlmn+,-9AC̾޾޾޾޾ޚ޾޾}oaShJVfhH5OJQJ^Jh^hct5OJQJ^Jh^hH5OJQJ^JhH5OJQJ^J#h\hct5CJOJQJ^JaJ#h*hct5CJOJQJ^JaJ#hnMhct5CJOJQJ^JaJhctCJOJQJ^JaJ#h|uhct5CJOJQJ^JaJhct5CJOJQJ^JaJ#h-lhct5CJOJQJ^JaJ ()ǮȮmn,-9:BC & Fgdh^hgdct & Fgdgdct>JKBCxy,-^gdct & Fgd & Fgdh^hgdct$a$gdH$a$gdHgdct=>JKA,-¶öOP׷طٷ۷ܷ޷߷ƵԤƓƁƁo]UQUQUQUQhpjhpU#hBhct5CJOJQJ^JaJ#hd!hct5CJOJQJ^JaJ#ht>hct5CJOJQJ^JaJ ht>hctCJOJQJ^JaJ ht>hctCJOJQJ^JaJ h7FhctCJOJQJ^JaJhctCJOJQJ^JaJhct5CJOJQJ^JaJhJVfhH5OJQJ^JhJVfhct5OJQJ^J67öPQηϷзѷҷӷԷշַ׷طڷ۷ݷ޷gdct & Fgd^gdct8^8gdct & Fgd#@Ytu~޸ '4 $@&a$gdpIk$a$gdpIk$a$gd\m$a$gdKh]hgdE &`#$gd$a$gd\NWkstuv|}~ݸ޸ ſſϪok]R]R]Eh\mhFvOJQJ^JhFv5OJQJ^JhZhFv5OJQJ^Jhp,jhKhFvCJOJQJU^JaJ*%hQCJOJQJ^JaJmHnHu hKhFvCJOJQJ^JaJ)jhKhFvCJOJQJU^JaJ hFv0JjhFv0JUhFv h\hFvCJOJQJ^JaJh9CJOJQJ^JaJhFvCJOJQJ^JaJ'4;CDEklmn_ȺȺ~l~ZF4#h_qhpIk5CJOJQJ^JaJ&h1hpIk5>*CJOJQJ^JaJ#h1hpIk6CJOJQJ^JaJ#h8ahpIk5CJOJQJ^JaJ#h1hpIk5CJOJQJ^JaJh8ahpIkCJ#h:hpIk5CJOJQJ^JaJhpIk5CJOJQJ^JaJhpIkCJOJQJ^JaJ h1hpIkCJOJQJ^JaJ h.ThpIkCJOJQJ^JaJ#h.ThpIk5CJOJQJ^JaJhFv4ElmnM_`a -Ifg & F gdpIk & FgdpIk$a$gdpIkgdpIk $@&a$gdpIk_`a I[efghXYvvdRRChpIk5CJOJQJ^JaJ#hnzhpIk5CJOJQJ^JaJ#h1hpIk5CJOJQJ^JaJ hnzhpIkCJOJQJ^JaJ h1hpIkCJOJQJ^JaJhpIkCJOJQJ^JaJ#hnzhpIk5CJOJQJ^JaJ#h1hpIk5CJOJQJ^JaJ heVhpIkCJOJQJ^JaJhpIk5CJOJQJ^JaJ#h8ahpIk5CJOJQJ^JaJhFvghXYZ[\ѼҼӼ&'?L] $@&a$gd: $@&a$gd$a$gd$a$gdpIkYZ[ѼҼ&'?LS[\]ؽ鳢tbYUC#h8ah5CJOJQJ^JaJhh8ahCJ#h:h:5CJOJQJ^JaJh:5CJOJQJ^JaJh:CJOJQJ^JaJ h1h:CJOJQJ^JaJ h.ThCJOJQJ^JaJ#h.Th5CJOJQJ^JaJ#h8ahpIk5CJOJQJ^JaJ#hnzhpIk5CJOJQJ^JaJhFv#h8ahpIk5CJOJQJ^JaJ]ؽ>?׾ؾ 34"#Ri 7$8$H$gd.T & F*7$8$H$gd.T$a$gd.T $a$gd.T & Fgd$a$gdgd $@&a$gd:ؽ>?׾ؾ 2348WX]!"#R׳פpppp鳤^Mp h**h.TCJOJQJ^JaJ#h1h.T5CJOJQJ^JaJ h.Th.TCJOJQJ^JaJ h.ThCJOJQJ^JaJ#h.Th.T5CJOJQJ^JaJh5CJOJQJ^JaJ#h.Th.T5CJOJQJ^JaJ#h8ah5CJOJQJ^JaJ#h.Th5CJOJQJ^JaJh#h.Th6CJOJQJ^JaJiBx V$a$gd J$a$gd  $h^ha$gd $a$gd 7$8$H$gd.Tgd.T & F*7$8$H$gd.T4<BMX&ͻssdRdRChFv5CJOJQJ^JaJ#h(hFv6CJOJQJ^JaJhFv6CJOJQJ^JaJ#h(hFv5CJOJQJ^JaJ#hJVhFv5CJOJQJ^JaJ h(hFvCJOJQJ^JaJhFv5CJOJQJ^JaJhFv#hjhFv5CJOJQJ^JaJhFv5CJOJQJ^JaJh#h8ah.T5CJOJQJ^JaJh.TCJOJQJ^JaJ&U567?IXxyz{ ȷڥȷȖȖȷȖȖڥڥȇuuoȖ hFvCJ#hY=hFv6CJOJQJ^JaJhFv6CJOJQJ^JaJhFv5CJOJQJ^JaJ#hJhFv5CJOJQJ^JaJ h(hFvCJOJQJ^JaJ#h(hFv5CJOJQJ^JaJhFvhFv5CJOJQJ^JaJ#h(hFv5CJOJQJ^JaJ+Vp67Xyz{&A$a$gd4$a$gdct$a$gd J&4:@ABCDENYxyz{=G[\t|}~q_#hXhFv5CJOJQJ^JaJ#hY=hFv6CJOJQJ^JaJ#hJhFv5CJOJQJ^JaJ#h1fhFv5CJOJQJ^JaJh(hFvCJaJhFv5CJOJQJ^JaJhFvh(hFvCJhFvCJOJQJ^JaJ h(hFvCJOJQJ^JaJ#h(hFv5CJOJQJ^JaJ#ABCDEyz{}~+,-.{$a$gd2gd4$a$gd4+-.8ehz{67XYvx;횖sbTbTbhFvCJOJQJ^JaJ h7LhFvCJOJQJ^JaJ h7LhFvCJOJQJ^JaJ#h7LhFv5CJOJQJ^JaJhFv#hY-hFv5CJOJQJ^JaJ#h2hFv5CJOJQJ^JaJhFv5CJOJQJ^JaJ h hFvCJOJQJ^JaJhFv5CJOJQJ^JaJ#h]hFv5CJOJQJ^JaJ 67XYnz$a$gd2$a$gd, & Fgdgd2$a$gd2:;GMUV&'()*+lȹȧȕtmdȕR#h[hFv5CJOJQJ^JaJhY-hFvaJ hZ;hFvhFv5CJOJQJ^JaJ#h=hFv5CJOJQJ^JaJ#hZ;hFv5CJOJQJ^JaJ#hZ;hFv5CJOJQJ^JaJhFv5CJOJQJ^JaJhFv#h_1hFv5CJOJQJ^JaJh,5CJOJQJ^JaJ#h_1h,5CJOJQJ^JaJ&'()*+lQRSTUVWXYx$a$gdctgd>b$a$gd>bh^hgd>blQRSTUVWXYZxyz{WӠӠӠӎ|j#hZ;hFv5CJOJQJ^JaJ#hY=hFv6CJOJQJ^JaJ#hY=hFv5CJOJQJ^JaJhFv5CJOJQJ^JaJ#h[hFv6CJOJQJ^JaJ#h[hFv5CJOJQJ^JaJ#hZ;hFv5CJOJQJ^JaJhFv hZ;hFvhFv6CJOJQJ^JaJ$xyz{)WA $@&a$gdC}h^hgd $h^ha$gd$a$gd$a$gd>b@AWw 456ABDEFubYhY-hFvaJ$h=hFv0JCJOJQJ^JaJ/jb,h=hFvCJOJQJU^JaJ)jh=hFvCJOJQJU^JaJhFvCJOJQJ^JaJ h=hFvCJOJQJ^JaJ#h=hFv5CJOJQJ^JaJhFv hZ;hFvhFv5CJOJQJ^JaJ#hY-hFv5CJOJQJ^JaJDEFghJKpdh-D@&M ]gdjp -D@&M ] gdjp & F -D@&M ]^`gdjp% & F (# dh-D@&M ] ^`gdjp-D@&M ]gdjpgd $@&a$gdC} FfghIK:ؾ~nanL; hchFvCJOJQJ^JaJ)h+hFv5>*CJOJQJ\^JaJhFv5OJQJ\^JhchFv5OJQJ\^JhFv)hchFv5>*CJ OJQJ\^JaJ )hchFv5>*CJOJQJ\^JaJ#hchFvCJOJQJ\^JaJ2hchFv5>*B*CJ OJQJ\^JaJ ph30+*hchFv5>*B*OJQJ\^Jph30+!hchFv5>*OJQJ\^JKQ_`' & F(gdc & F%gdcgdc! & F dh-D@&M ]^`gdjp:@PQV_^_`W~¾zi_R_ih*dhFvOJQJ^JhFvOJQJ^J hchFvCJOJQJ^JaJ h]hFvCJOJQJ^JaJ)h+hFv5>*CJOJQJ\^JaJhchFv5OJQJ^JhchFv5>*OJQJ^JhFvhchFv5CJaJhFvCJOJQJ^JaJ hchFvCJOJQJ^JaJ#hchFv5CJOJQJ^JaJ KL'(!"OP?@sgd~gd'gdc' & F(gdc'^gdc DHJLyz#%&'(ﺦuudﺦQ:d,h~hFvB*CJOJQJ\^JaJph30+$h'hFvB*OJQJ\^Jph30+ h'hFvCJOJQJ^JaJhFACJOJQJ\^JaJ#h'hFvCJOJQJ\^JaJh'hFv5OJQJ\^J'h'hFv5B*OJQJ\^Jph30+*h'hFv5>*B*OJQJ\^Jph30+ hchFvCJOJQJ^JaJhFvCJOJQJ^JaJhFvh*dhFvOJQJ^J !">?@q®tcRD2#h+hFvCJ OJQJ\^JaJ h'hFv5OJQJ^J!h'hFv5>*OJQJ\^J h}hFvCJOJQJ^JaJ,h'hFvB*CJOJQJ\^JaJph30+$h'hFvB*OJQJ\^Jph30+h'hFv5OJQJ\^J'h'hFv5B*OJQJ\^Jph30+*h'hFv5>*B*OJQJ\^Jph30+hFv h'hFvCJOJQJ^JaJ#h'hFvCJOJQJ\^JaJqrst|űp^^Lű5^,hB@~hFvB*CJOJQJ\^JaJph30+#hhFvCJOJQJ\^JaJ#hB@~hFvCJOJQJ\^JaJ,h+hFvB*CJ OJQJ\^JaJ ph30+,h~hFvB*CJOJQJ\^JaJph30+$hB@~hFvB*OJQJ\^Jph30+'hB@~hFv5B*OJQJ\^Jph30+*hB@~hFv5>*B*OJQJ\^Jph30+hFv h'hFvCJOJQJ^JaJhFvCJOJQJ\^JaJst_`gdVtgd'gdB@~_` ޸saL޸a7)hVthFv5>*CJOJQJ\^JaJ)h+hFv5>*CJ OJQJ\^JaJ #hB@~hFvCJOJQJ\^JaJ hB@~hFvCJOJQJ^JaJhFvCJOJQJ^JaJ!hB@~hFv5>*OJQJ\^JhFv h'hFvCJOJQJ^JaJ#hhFvCJOJQJ\^JaJ&hB@~hFv5CJOJQJ\^JaJ#hB@~hFvCJOJQJ\^JaJhFvCJOJQJ\^JaJ $%&']_%&\]-DM [$\$]gdB@~gdB@~"$%&']^_$%&\]̺r̺_H7 hB@~hFvCJOJQJ^JaJ,hB@~hFvB*CJOJQJ\^JaJph30+$hB@~hFvB*OJQJ\^Jph30+#hB@~hFvCJOJQJ\^JaJhFvCJOJQJ\^JaJ#h`hFvCJOJQJ\^JaJ!hB@~hFv5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJ#hhFvCJOJQJ\^JaJ h`hFvCJOJQJ^JaJ hB@~hFvCJOJQJ^JaJ]IJKL{|<=>?{gd`gdB@~ [$\$gdB@~h-DM [$\$]^hgdB@~ & F -DM [$\$]gdD & F -DM [$\$]gdB@~]HIJKL{;<=>?{|´ВnjYDnjY5hFvCJOJQJ\^JaJ)hB@~hFv5>*CJOJQJ\^JaJ!hB@~hFv5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJ#hhFvCJOJQJ\^JaJ hhFvCJOJQJ^JaJ hB@~h{{CJOJQJ^JaJh{{CJOJQJ^JaJhFvCJOJQJ^JaJ hB@~hFvCJOJQJ^JaJ hB@~hDCJOJQJ^JaJhDCJOJQJ^JaJ{|*+,-rs]^_34 >gddgd`gdB@~|)*+,-qrs]^_3ʸpbܸܸQ!hdhFv5>*OJQJ\^JhB@~hFv>*OJQJ^J)hB@~hFvB*CJOJQJ^JaJphhFvCJOJQJ^JaJ!hB@~hFv5>*OJQJ\^JhB@~hFv5>*OJQJ^JhFv#hB@~hFvCJOJQJ\^JaJ#hhFvCJOJQJ\^JaJ hB@~hFvCJOJQJ^JaJ#hB@~hFvCJOJQJ\^JaJ34 =>?ȷȃudRd?$hdhFvB*OJQJ\^Jph30+#hdhFv5CJOJQJ^JaJ!hdhFv5>*OJQJ\^JhFv5>*OJQJ\^J!h~ihFv5>*OJQJ\^J hYhFvCJOJQJ^JaJ#hYhFv>*CJOJQJ^JaJ!hYhFv5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJ hdhFvCJOJQJ^JaJ hhFvCJOJQJ^JaJ>?;<=wxgdk}gddYh;<=vwx{ƴ~p_H1H-HhK fhdhFvCJOJQJ^JaJ-HhI fhdhFvCJOJQJ^JaJ hYhFvCJOJQJ^JaJhdhFv>*OJQJ^J!hdhFv5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJhFv>*CJOJQJ^JaJ#hdhFv>*CJOJQJ^JaJ hdhFvCJOJQJ^JaJ#hdhFv5CJOJQJ^JaJ,hdhFvB*CJOJQJ\^JaJph30+"*:Gqy /7חudRR#hdhFv5CJOJQJ^JaJ hhFvCJOJQJ^JaJhdhFvOJQJ^J!hdhFv5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJ-HhI fhdhFvCJOJQJ^JaJ-HhL fhdhFvCJOJQJ^JaJ hdhFvCJOJQJ^JaJ-HhJ fhdhFvCJOJQJ^JaJ78lmn٘n\M;)#hhk}5CJOJQJ^JaJ#hhk}5CJOJQJ^JaJhk}5CJOJQJ^JaJ#hhk}5CJOJQJ^JaJ)hz^hk}5>*CJOJQJ\^JaJ!hdhk}5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJ-hdhFv0JB*CJOJQJ^JaJph/jA-hdhFvCJOJQJU^JaJ hdhFvCJOJQJ^JaJ)jhdhFvCJOJQJU^JaJ  & F -D@&M ]gd2$a$gdd-D@&M ]gddgdd K-D@&M ] gdk}@&gdk}gdk} );<JZqϽxfxS$hdhFvB*OJQJ\^Jph30+#hdhFv5CJOJQJ^JaJ hdhFvCJOJQJ^JaJ hYhFvCJOJQJ^JaJhdhFv>*OJQJ^J!hdhFv5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJ#hdhk}5CJOJQJ^JaJ hdhk}CJOJQJ^JaJhk}CJOJQJ^JaJ 5Z[ct347Fozp_N<#h\phFv5CJOJQJ^JaJ hhFvCJOJQJ^JaJ hhFvCJOJQJ^JaJ hhFvCJOJQJ^JaJ#hhFv5CJOJQJ^JaJ h'WhFvCJOJQJ^JaJhFv5CJOJQJ^JaJhFvCJOJQJ^JaJ hdhFvCJOJQJ^JaJ,hhFvB*CJOJQJ\^JaJph30+,h~hFvB*CJOJQJ\^JaJph30+ 6GP[\bct  3-D@&M ]gd2 & F -D@&M ]gd2-D@&M ]^gd2 & F)-D@&M ]gd234 []^_Zgdd @&]gdd-D@&M ]^gdd-D@&M ]gdd @&]gd2"gd2 & F -D@&M ]gd2h-D@&M ]^hgd2 \]^_ZXYZ[ャpᬽ_Q_hFv5>*OJQJ\^J!hhFv5>*OJQJ\^J)hz^hFv5>*CJOJQJ\^JaJ!hdhFv5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJ hdhFvCJOJQJ^JaJ#hdhFv5CJOJQJ^JaJ#h8hFv5CJOJQJ^JaJhFvCJOJQJ^JaJ h8hFvCJOJQJ^JaJZ[WYZ[defggd-D@&M ]gd @&]gdd-D@&M ]^gdd-D@&M ]gddgddDcdefg    B D   + , - . / 0 ȷpbȷ^L#hBhct5CJOJQJ^JaJhphFvCJOJQJ^JaJ hhFvCJOJQJ^JaJhFvCJOJQJ\^JaJ!hhFv5>*OJQJ\^JhFv#hB@~hFvCJOJQJ\^JaJ hdhFvCJOJQJ^JaJ hhFvCJOJQJ^JaJ&hhFv5CJOJQJ\^JaJ#hhFvCJOJQJ\^JaJ    B D     + , - . / 0 gdctgd`-DM [$\$gdgd-D@&M ]gd K-D@&M ] gd< 00&P 1h:p*!9. A!n"n#n$n% F ˜v.= 1 ExifMM* '(1"2ևi$-'-'Adobe Photoshop CC 2017 (Windows)2017:01:12 16:17:120221yrz(HH Adobe_CMAdobed            Y" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RI$I%5:Q[\d{Cy`3b{ 漎Cjcە﮿?k[zv~{ha'Yw=Zŏ,Ru&O~8DbcM[i0Ř$H1bt7{q3\}¦zU˰zD9qn[߸U+YA+] n+k~Ym/Oc./gq$L #$>ɝ'ݱ۽],k1syc7#i/?e,kvdNVv^MP汕W1̐-ۼ7) x)>Q̩O8 bW.R-~Y1|[#HOE.Y)8Tk鶊e}:^N/jk+mÞƝ~b9ˆ@.)F+IE86mݚ ]?ѹ\ @0^GoOժ>tdTސs^ok7g[ֻzZ΂O٨}5Q>/?ǥie` \>|-(L~-Ϯ?ZrᲫ,} ick龿Ybgtպ^E@.dFb_Z{s_]?Fv'YDXz=Ӎc*'Vv~8q% #2#'?lǂzy^Fv]N5Y]>de=z7JʧGB0:.c~tq~;kgau_Xc6zy5XX1ߍҾU-ͺ, 6~"9O!C9 b@$Hlh@Pۀ;+K~~1e1%ti'vrBYA5e"c"@TI%)BE4qk+iyk4S;/7=/wn>Dügٶz_.NS>~ ٌufb}K$}`GP+yRSM2`tMֻ' ѹgzۨ~عNվddeb_F-vXkY?3oVQgk,c>=+^б|HVY_V?X:`4_a[-\_t,0mö-mo!Wߥ_NϠW0.\eurqZ c} uζmi)>^659ֻh(cuP- ?N2lfn[~lq}c}tue; ukc]S_2- v0tTN%9k'9bJ{ԗ2nV~]K' 0s)`{uq-US#~uѮ&Usf=UY~\OOU-J{ӫe6[ciw.WUmj'f}E~Eݟ^=}F_K{?=SI2aU/&ݔFE&kvO]{m~ /,=O}](ο#_Xs}[YCes=l?#l̆u/^׽:k-^];_g쮽m)B'Xme-kXm*JT*qk[$=p-8E^auGk"GSۋpO]i)򱭨]}-5GҗچΧӬf%y5?&zk\gƃpkniоYŷWhU]ytO8$QA 9^9[({;=)?Fs~.}kA;:Gٌԭnˤk+;?S>[ ָz8&UQcWo׵rMOo?^ͯ_H{15ٙ/_}8_oIY%;+ecR+,vU^kHq-nƻn<~Һv>Hʷ׷!9z݌[x=Pg)ؖfPpuRJ_-^:ϟwE ʢL}V.~?FG+߁ѱq(u?YeelggozW-tAmqu ~Sj־AgP ]nEoȰ>c-]^b׾>nU]Y"*e,s.폳{SuSV7\0@n[Sk{7e~E]O3*V}!N9>k57m[-]s6N3z-(cgX3}Oclk?lYz߬OWnN-xcg9Y[Wo%=}+tN݅i饮vmR~.oF][''t^b: Լ1~#]/Jo!XbgINOjozXM[[e{=އw]a\ʦ;WZ{Y%>}A'=f_U8X_^U[}9cCmf&*^_~xơfXvM`X+^bJw[[z30gMf;w7sk,kgٺH7Qr:7wU?##Zvg.£7|1}uzeeVWʽ6TM?cs&RZ^ʘr.e }^W]^OSJzo =c}YY.nev_ٱIk.oZ=W6+gLͻ)2N5%?UuϩTu8]mo잗ւۅaw=t$RlN1}'Ym},{V-'`?{6zfŰ>guL1:XݾY]We?!sh['B&R/ȑ]G2ތ+er1zEΥٺsK=\v쭞]߬YR3>e?_zoUWWPc*=MƺcHdh/~F%ަU^;*Ⱥ3o,{K̶1N QCk1nnUjoӋ:sFRn^7O-qgCv[鉰:.wg)X}rNF+q>ϴ@gOاҳGH}fs=iwkj7_n:^^c3s>^6;3 6'k+e_M4aoMqx:/t~}[f<tM6ˀe̳o|nOxVu;w\}6}k[cϰ[k쭍~~ŷdٓf%.kvWA׷꭫gbɀEz`dc?ԱGgu_WFgTDm"}V6]z[v,kzY7u E ve;zoiu?nKƵّ4 a>c}ΊG#6XcZ>9}},qhr7i8>:+Ywzlm[˶ڹoa՟neZlL~xXFS}VݺNzͻzA؟YU9nm 0e}Zkz+)`/A#;5mԱXJZr2Ey,7۷WmVZ)ֻni6WYcv7sI?Hv;,~-y'=s\{[in1 *qP)\zI 2$D:qUev[T:VO՞2\ 匥ެܜ+nïK2?ZT|:qn,Gn͈}?9NkoU3擲~ksDo5f/smm7WCڲY c'#ja[;8\ovyv?~͟Mk,o_u7gvPLYc}*Y__?S' mS !TI%)W&kvjqc~׫ #7T|\t5-Chk6Fne{#uX zq}Z))Oz_WӇ8xoĠ;es.szn}- ]6~I7_O }8\3)km}^ns},}.'@g5Ayt7%ܴN>kVoޕu8RVS];w9-祽hݑK \+6mzxV~ϡk$rME~ r5o;Y.~qۓQ6>1*u}9ȫRC~j|CҸwZ CcQ.'oo~l3,c2@vWsMVL>Gqݮ׆ gΞ\fڿf[ַozmelN>3_x!]8[gҳӹRR~J֟j_M,.\MbwUu$SU N Photoshop 3.08BIMZ%G8BIM%}Ǿ pvN8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjc Proof Setup proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM 8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMIy CMYK BLACKynullboundsObjcRct1Top longLeftlongBtomlongyRghtlongslicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongyRghtlongurlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM Y Adobe_CMAdobed            Y" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJI$RI$I%5:Q[\d{Cy`3b{ 漎Cjcە﮿?k[zv~{ha'Yw=Zŏ,Ru&O~8DbcM[i0Ř$H1bt7{q3\}¦zU˰zD9qn[߸U+YA+] n+k~Ym/Oc./gq$L #$>ɝ'ݱ۽],k1syc7#i/?e,kvdNVv^MP汕W1̐-ۼ7) x)>Q̩O8 bW.R-~Y1|[#HOE.Y)8Tk鶊e}:^N/jk+mÞƝ~b9ˆ@.)F+IE86mݚ ]?ѹ\ @0^GoOժ>tdTސs^ok7g[ֻzZ΂O٨}5Q>/?ǥie` \>|-(L~-Ϯ?ZrᲫ,} ick龿Ybgtպ^E@.dFb_Z{s_]?Fv'YDXz=Ӎc*'Vv~8q% #2#'?lǂzy^Fv]N5Y]>de=z7JʧGB0:.c~tq~;kgau_Xc6zy5XX1ߍҾU-ͺ, 6~"9O!C9 b@$Hlh@Pۀ;+K~~1e1%ti'vrBYA5e"c"@TI%)BE4qk+iyk4S;/7=/wn>Dügٶz_.NS>~ ٌufb}K$}`GP+yRSM2`tMֻ' ѹgzۨ~عNվddeb_F-vXkY?3oVQgk,c>=+^б|HVY_V?X:`4_a[-\_t,0mö-mo!Wߥ_NϠW0.\eurqZ c} uζmi)>^659ֻh(cuP- ?N2lfn[~lq}c}tue; ukc]S_2- v0tTN%9k'9bJ{ԗ2nV~]K' 0s)`{uq-US#~uѮ&Usf=UY~\OOU-J{ӫe6[ciw.WUmj'f}E~Eݟ^=}F_K{?=SI2aU/&ݔFE&kvO]{m~ /,=O}](ο#_Xs}[YCes=l?#l̆u/^׽:k-^];_g쮽m)B'Xme-kXm*JT*qk[$=p-8E^auGk"GSۋpO]i)򱭨]}-5GҗچΧӬf%y5?&zk\gƃpkniоYŷWhU]ytO8$QA 9^9[({;=)?Fs~.}kA;:Gٌԭnˤk+;?S>[ ָz8&UQcWo׵rMOo?^ͯ_H{15ٙ/_}8_oIY%;+ecR+,vU^kHq-nƻn<~Һv>Hʷ׷!9z݌[x=Pg)ؖfPpuRJ_-^:ϟwE ʢL}V.~?FG+߁ѱq(u?YeelggozW-tAmqu ~Sj־AgP ]nEoȰ>c-]^b׾>nU]Y"*e,s.폳{SuSV7\0@n[Sk{7e~E]O3*V}!N9>k57m[-]s6N3z-(cgX3}Oclk?lYz߬OWnN-xcg9Y[Wo%=}+tN݅i饮vmR~.oF][''t^b: Լ1~#]/Jo!XbgINOjozXM[[e{=އw]a\ʦ;WZ{Y%>}A'=f_U8X_^U[}9cCmf&*^_~xơfXvM`X+^bJw[[z30gMf;w7sk,kgٺH7Qr:7wU?##Zvg.£7|1}uzeeVWʽ6TM?cs&RZ^ʘr.e }^W]^OSJzo =c}YY.nev_ٱIk.oZ=W6+gLͻ)2N5%?UuϩTu8]mo잗ւۅaw=t$RlN1}'Ym},{V-'`?{6zfŰ>guL1:XݾY]We?!sh['B&R/ȑ]G2ތ+er1zEΥٺsK=\v쭞]߬YR3>e?_zoUWWPc*=MƺcHdh/~F%ަU^;*Ⱥ3o,{K̶1N QCk1nnUjoӋ:sFRn^7O-qgCv[鉰:.wg)X}rNF+q>ϴ@gOاҳGH}fs=iwkj7_n:^^c3s>^6;3 6'k+e_M4aoMqx:/t~}[f<tM6ˀe̳o|nOxVu;w\}6}k[cϰ[k쭍~~ŷdٓf%.kvWA׷꭫gbɀEz`dc?ԱGgu_WFgTDm"}V6]z[v,kzY7u E ve;zoiu?nKƵّ4 a>c}ΊG#6XcZ>9}},qhr7i8>:+Ywzlm[˶ڹoa՟neZlL~xXFS}VݺNzͻzA؟YU9nm 0e}Zkz+)`/A#;5mԱXJZr2Ey,7۷WmVZ)ֻni6WYcv7sI?Hv;,~-y'=s\{[in1 *qP)\zI 2$D:qUev[T:VO՞2\ 匥ެܜ+nïK2?ZT|:qn,Gn͈}?9NkoU3擲~ksDo5f/smm7WCڲY c'#ja[;8\ovyv?~͟Mk,o_u7gvPLYc}*Y__?S' mS !TI%)W&kvjqc~׫ #7T|\t5-Chk6Fne{#uX zq}Z))Oz_WӇ8xoĠ;es.szn}- ]6~I7_O }8\3)km}^ns},}.'@g5Ayt7%ܴN>kVoޕu8RVS];w9-祽hݑK \+6mzxV~ϡk$rME~ r5o;Y.~qۓQ6>1*u}9ȫRC~j|CҸwZ CcQ.'oo~l3,c2@vWsMVL>Gqݮ׆ gΞ\fڿf[ַozmelN>3_x!]8[gҳӹRR~J֟j_M,.\MbwUu$SU N8BIM!]Adobe PhotoshopAdobe Photoshop CC 20178BIM http://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$]moniO<IK$5ʺfn]ח}~lmOD0I#KvҊJ+1I uu%z:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{UUMEO5]eDSU4tFM+$qbP< 3ƁTId1H'u`fO,n"=qJG~ڳ? >oA}gxEiØnb<-a#G==MAdF(?˯{H/oϏ` v݌voT&gG揄Ge+W{aN_SqGGt6rIT}GGfrZ/kkVmbAɶ l=اcزjeyHl?-A/ee=}$>:Y%Ᏸݝ݄m}k$7 dVFj~ΆvV,w1I{ۇ?׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{EvVn݉3alӼFІkuAઘ(Z*7)]ĩ7s.r7Tk ) M#%={%=k'[Un< *g@X!6yGmz[3EPEt|y'|3J|iY$^{wB\V˟`=3`߿w9=З3վZ0Y`߿w9Hn=ǻ՛[vnOk鲹^=xꪥn:Ɛi_zko67{+_Y;PI <4rܓsӾwss+nژfB|zW{c]{{uNMݛ5?7uvػ17To*:| Ep(j4Ĵ1 (= {g~r7-]lVyc+41iR,jc_3㙹yy[[XV'J5XH;{}.g}?\F /CsIAuk쮽v_7{*Ǹ- 9 ;"ZG**74]l?MOX"x^S^DeNdN_}/`ZM%uO*?uD*:lu&>? %-=,@bH 3frI61q vr59:ډ ;"}rI1 {rx-/;Eݷxh f€*.aw{$5ӗbĉf ,I{ٻK`d{/}4-mu9lQy){sN5Xج0hZY BH|mʼ{H55;c0@igDf"PʦZ~On6 d ;M0+$G b$CEQ 1TVazz}kr8*ڞ m՛nrpR+Zi!a+uo }dw41JK 0AN<3Xͳԁ<^8©+t^>u+Loכӳ袦VSP@D4[P&m9C)Kkx'3"r|ى$zb>n4s515JPB{ : u~׽ߺ^x|eVܻ?-SSkr"Mԥn&Je[űYo51̇Yteo;p.mpxex>i/*廂^-=]1{o ;<}zI#3y2pXvT(j]lnO#>?Qyryfb-aUP o3$ hi:y,tssw3na1^_$\$Qk#E kvG+O{>؟}մ}Y[':u[ ~Ku~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{_gt< n,j Su laʿ֟O",k>_M Or~^cbȤnoViQ(uzuz9{]{߽u~׽ȤZZ*j*vzjyh'D!P27_SC2)VR*XP<yY`9ᐤ AȃzƮۦxM6{'|TZ 63~rdܓ*n<1šL7!1}{o͑s!r7F2RL%z^~{CcQ4[7C.ޏ?[Gq0G-.{5ivD{5H?i39[1,n^3 ?(׽r_Q^|?O[/?p2谛; Y5?[ck90d0Ab ̪x>_?߹ۊIo4$:Z?5I.?W.Z=ţ TY\ī,^D~@v$um[zMV; U+ௗpW->9d_y?Qb?ꗵ+&G핐u=Jp{u\)y"qv>Lm܍N {}>8\ڮ9ZsG_ϭn?L(q1:ߺ.Xx[Y4o"s/׽u~׽ߺ^sItڡPoSMVU#'чݏ[4z&m;aK^8oO)~imI%ܞK@GȬ!k׽sP^*%[GJU=4CTuRFڒi lO \H4,x*% =;2 Zy*ij>duD=K6|}%K=xz Y)wikKQY€^F6]?r;߹z|M52' 8ݶ-ێ@.VccY$<+Hzɧ~g{-3sk1?=f/3TݧyY"IQQeREQ{ .{\ĒorwNwC% &MdyG\w2YW P`N.#U}m"{{UK; 33*I<z$(,ƀu Rz ln*rF"ꄂNӽl3[+5tm;]cl?m:#x6*Ȭ>2يF2VF*C |=ۭu{)>B_hqwԚdRujEѱ1HߦR ;o>gӶÜ-,ݽzC~ύuոK~/qR uf[V]}~o=A+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{[_g~=u=EpZdk8z]eUɽ+QzvN?_|~c/dVQ724Qk ~N:QL]vA?ĴJz]=cu~׽ߺ^~{kOWUr1fӗ7;DF:ͻE?Kq{4vl{PlP'1i4w飯.׺@]msqvj^ -K#-֛5{#oU|_I|i#risݚv$0?/Tup\~h:ŷ I._^g?? jv5*gVx&/ %nY)b{~gPx''w+-H͵]\x % f+s#dks-&ҒR]r2cϯ{[rz^~{NSk>w[ͽ&1MĦG!gQcOOʞrdrfp,1Pu_.[(mP[LO_^io|{߽uhޔ]o;2z?l-~ Wg* 0PϳUخ9sm+[SR%n:&M\niS=xi&!fyNwe2y 䩮w?yYP6v65pTE |uus=̅e,ijO^ڎ/Ovzn|1]Qa~i£GzX۟pO?{,&LFb[ZDGI:Kronvsy3#nRz?/kWl#gꞞ{l;kO޹rqnU*VpNO}yh6M{)k8T$&@F@=tS>~赔۾ S@gд15r n׽ߺ^kc#bzAYQvgE^N Q uH0ս4?"GA#:/JyCBsv43qo gQFHë B{){ͻ4k~X"XY13 sT{KQ=_[`PR -9gymy%YZē<|ΗRso5;õIP>JTªun^R;x9cl Q@ 8UC1>lĒrI={ؙ)Г{Gn޼HclC"v.x7QVBo+og{/3s'.L.y{/.ki偁νnܿo7ݎ(VxciI:|m][YSr' +}NGp8?eIE5E~rF{a|BŐc[1OIWOXοt/eT{5bw_~, 67RCAPcq4㧢:Z:HpĨ{ī뫛ɚKgwl;bIj ;k{KXv"(UPT |G+O{>b7ViGӠWЧ|^'^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{OOf҂GԽosBfa p۾-uSʟ}ra d;OEl}eNO~<ޙ;u<Vn]{؛ҽ}7lwU|Q'bv.ZXcX,bƐQT>œ̉ɼ&;fuuC!yB$ %́[ ڣJbkR{}WNZڱTN^TAʀk/Fl.a۞oCu". FH{{I>i+6dG"7$M.>L:Ӡ^p?'ѧ ]WnycRD7~٫~Eu8>|a7ߑ^6 nH~uTP9s,߼pl˦z؂{|dQ Ŀ9i׽g=v+{S_[  ޻iYL1}-JNʞ?9HycxAX]7|1hėHu|bndm}i\-Oɏ^u~׺?[v>)nĩvke>}68?Eøj2'?9f)+o=ԏ+Vu֯.~z #O6Ѥi%3{<vG﯎EFjnS+mٗX)[UٹCi=Ϳݭ/{ΒG[YFޟOO(龦D?bwoJ9?ǯ"?~Z={޺^w<{^EqcW'Wݥ =I]-6mōTj*|ȲS0^C%ahJK9{?kE4 uϸ.rm㤻q/{4ȵNj_s>W}$U^#eW׬ussخvtMEh?Q8/J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{s)*>vvK_!혃܇mJh<8*R}Z=(%y>s3ϯu_="ɪ?#,#P~]{y%v}z ꊉ׸ع%ӨGnV0؄}לǽXX}gs_w^q$umd?uQSL{ܫ#Ǫo^,'#tF O#%Mm@M 6K3H7'w=X}y6mWʫ\[S}s8(97;o5-7,iL2mIO7 VT__vb3}{ŀ5mf(RԞ9Y${w-s*')CCrLV^ Je7_^Yl{{6ʯ1?b|ݙl^޸ **cb1YZ 4gơ员ݘ^Ơ>gi E/$3 Q4U`G^uѱ{YP# ۘ@X$UZ4I9'{R+o_wWeZz1^xsno^w>eW|ؿ{wWeZz{Scw[z7`88vhm6ܧ{v49ZX*Qcsj44 RW[nMv@vѢ1,1Vd/hIZЕRE@6gmqۖA y8I$e 0 J׽]z{^^ӞFfӥ>'6uO UqqxAC_'!rV-ibi}=z#~Ϛ:I$ }R S׽g'n^iVW^Q(L`[PʟwQ9 9ԽٴMn7o(Oa8ez|4pu<}=Kڝe!׿:Z/`bҖ$#!&{FjJIਦ) VXfU*2 X9^PAVR*#FRG$2I ѲJC)A9{Ω׽ߺ^!mMn8woTێ Wi+֒hP9t ,C!ajS睭nq=kjI(Rq5QǓWA-g3rv⛷*{~?4dm$SOg.;gd{So )v`SVVaTl"a<)$ҷ{ܙ%N.Ϲgc/u՘zz_n><ٴ;,{76`͚<[}Esï{>MMTͯUBJ=ɶDYL\MRcfYPjs='>rs=|)pNAYA%@:臷GO~LbiGO 4-GCQJ3^u~׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]/6wfGVlެ޹|<SYۅ^C秦/{_뿺~G 9i~΀~GێxUL{]̑oP~}{#_?{߽u{|:Ȯڞ #]bYӖܹb{X}q70LJEf)p.^wp [{D><4xL:_$9RyKk;[pHCsRF,HYc<>|Vynm;0XmBhQ/HvroߠUy@xGʲE+zuzl{?\{{{ݫ:7\=1s k&H2Lϭ)ٹ dnUx!x%o_u:6Sx71M!@uOi~[iYZ,%smtm<2~uG{??w>wx޴1ڣ}y[v+kEqe?5^S^+SnU]=cTBO.*zmѸ1S0?EXc…$=9ۘMlٶ>/-?=4̚<<\ |]Sƕ#媤^pŏ0,a'KnxRAWH{TH̳z&n$DEAT~׽g}UiOeWy>w޵"SymѸ2 xn{y^CVޞ۷[Z8REz^gcIn&k4%?-TbN:{^{{u׺{^{{u{wǜDǴfZ+ZlGycXzf)!_ώ%>yl{zjH]GI- 3r=E$j>J:z]`c;sX̉?E]Ư"]orԵXj#`Zvov\vn܅B EY_1TQo~;'Wɗ1m%ZU`Ehfo2+92dw|YWXM>ig50lƵ^c$Dk?nmn͖Pm1Wnf830}-\ՈIJ_:jLf|J{~${{uV^ߏ}5Sw` M+д^;sEc QK:n6A?rgp.s#n*ú7 ,/E*V"#*H"L^e,7I-whOkFOHd`A{ޟ7#m`giv`H3SɓG&YquPg=Y~|=ow;Mϓ7 Z}}En@ RaR{쿺gek &rPx`$D뫸0mK{hdunr?ūi~y?{hS>/J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]O#WkCQ;$Fv*BQk0̊H͏'+~wxͶ]]T"i8u}nc֒Rmp0^WN׺?]s 5]uP˦I1X&8T6cT>s\ߦRJų6y %x)q?%vGߺ=%w;)U`x$#ǯ{?muau~{e]rFq2UDTQז&2ȊAy?oy39kv?_tZ @-KIz.iNk`'Ynh2溵^{g1Nٻg3sm}TFmAZVҺx[ѵod&{m7G2,ߚ=|mͺn[>IU"r){.u{ ^]љ=h7{ i~*r{{rI<1/_\^C[f g]H9T_F>>ܑq- , NC{z=O]m~yMDq~윚#` }ۜ=XX}gswnp94nrXfY%=VL?:&~蜹aוx[mx/ &H<k/ gZwlc*iz|<5D&'O~휯qݍ ݢE1YP~F8~Wٟq&vK 1%-c#e#:=׺:Q @|Mv6mg!`EAǒWxw죩XO xypka-m ),d Ȅ׬&Xo\WʡpAu8!e7%{|&X{~sAu/_ ~d={߿Mx/vQ^- "zc^#½[7׿%'E@z; ~l?6^oQS *%< &*) wcjmw?le'/u,^WxQ.V$Hs@\L*hf,aؿz\Q(H U&d?׽];m<~l*+g249:ꪔq>˷d7MYK<"Fz_m6k[~lï{:-ٛWl:xSo*;Xl] i_J覥Qa[w[˙g9ُ_DVo{nfQ{P{-^~{Nww 'Sdu_kd!$FS=hvwRKr#z =%'ܬ⸱trFFX|#{SrCe=w:4mK`UV8%?l*X*ccs/k>>r;|&.N_]MsxKeo8%+mƻVoڱGt^]~EkLhUU YvRIu5z1UES5tDfC'Z=߹2xJͬ-ͫ%D Cʌѽ֎̿u}/gٹ|C5Dcb uYe[ܿ]׽ߺ^~28~O[笢pҳwu;A:b *̬ц9?uH v6= .k?pgn& .5ȴwj#O{^Z>h|ioۧܫO>fj>ߨOtⷹ{ϋҗ\{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]}vWo??O>;26Q흿4IK&|ܫ^.coO6`ҎOyc i$31^o׺κO/x>ַ Ի6ltxsO7*ۃVosϿ}/Ʋky5) 0Ӯ{5_j}Z=3CۙF%fwOԗ׽3z_yj*Ow'  h~i'nePg:^V 7zt^.%NtDDm,Qڜ]oO޽oG|Ʃ+#qZXޱ{{GgBv^LǷw#4DOckdQ;8Ժ~p;#fwPVr`X'^\"s%4lqYUr@O:Ǡ^~{_}SOfgukrӫK0G˿)jǒb-"AƸI뢟p\׹{Gq4`'{ٶ|ݑz[J5[63p A{mW̲[}fHOUz>\ڭ`JMuz_\{{o|ڪ%V[s}d?=ʹ>TRU84>Ex,iI:}򳮐~׽";z{< X}Bą2e0w!Y</J]p{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{oy QcgVgE&zB~G$,?}_HF{>~eBH ۚהeT[[2#)$ $qjhTDEUUE-݉bjI$UT* 8׽׽?'HWyc<ޕ{G=4Ig]45=]\znmI@Kߩs9_?s3Rv[A86:G4ޢ^ o.JnweA)EM*8T?}{߽u~׽ߺ^Io7䚟Y|oE98bFVr?㵤ٶKAN `ho:g.~Fqx6stkJOʖڗzvG^O'*FSpE,q{^~ζyqܯ>s7%whԞ&;(C>^%܋ɜV; a%ܥH?=ѷï{o}:{^UKq#3ݣbV#.JI3+r8=M2rGQ'~boI&}ODU eOO]/c6[Lj:O1~3{I4ϹZ)̟PVO^GN׺@oolmZYn~1U]op9ްaG|v&횪~?,)qc&ucrTUQTQc"Ot. IȘM:[dnviUwT uVWWJ2[.n{c}73E Guv()TXZMU!Ϥ@x 5r,qnޟVU9܍_C6=ژnΔ?v=׶<[JnH=>9<mc#+hCm%HO`ᕾM;)OSKGg8O~*oː2 x˾}>,#T-hg " [#tHd{de7ɾ1V9kaM)Yp}WycڍU|`uNy/c ܽM<]{}U_aU>rУq;dghI$Mq+MJITvLʟp1\BeY1̗wQ1 DVs&EeJ%Fz/7 [mk1 "^'{޶<Wg|)/V 8r)uTo>w㖖 z8%i'~}<o nzW*j!0[7qpG!cH}ţ1F/FaC,Q|YR5%QAi=P^~{ӿ/CmjPM; bI ^[nmuw`UmoG(z?n6_q/+E$RYuWu+v.׽?G_,Z{}v*OٿZO7?^:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{_'r|BRcT5y*MJ!&cΥVVEDQřUIuݛl.d o3Tb~@zh쌖wf6tsJI\GqǿQ9O9ginoj'_;Ͻ̼Q3j>KU :)r''r΍/a[@7Y c'{}u~׽O {'|.Z@?y~}Ky_u?+[(rOp+d>]s]Ryȿie}{޴~7:{^Bo [ݱI6bxQo.|V>hQI[}fPWsZ✻$n{>Ƒu;k>͈ K}:zvܹNv5Th~uM1FM"WlsRZl*Wޙz^H>({{u׺{^{{ρ?۳i*mN'1S0:IU6kT`n}%>9\MS/b9~x^sG,CTA =ΓX%^b E<'f{A CoQI'aUb<z[juyԻhl&?om5o /NigyY٘#xwn`{V9,ƃ UQ@U@ǵrͶrfE QD$,Ėf%$jdueV]}ʾoA+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{݃7OƎ}Cm>x0-~˷+hQdVxnTc٭Õu}y[rĆ9%-L I# 2;?1sV_Qw{l&%C`Ff MA᝿Zo1 kEn$B]_^go#>FL7Q_۟/m׽ܗx?tvJ}m-JGvv#Vk3uhN9w/r'-o-g7Dۄub0,|4+_t?by}kHm=Ѥi'ˤ)={{WY׽ߺ^~{ޠ,/.Qn^3vR.<KR.E[oS(50d.ݬo쭏s:IktV1;鎻qଆHmȋ1h䗺tv=J4k'qug9J帎E;CROgo#>FL&eŠ.폨/0e~vb?iltl/~{]^ L"vm}{؟=Uxn]W2=S[:p7$j|"F ϰ>=~GS~g}m#=w- \o$ĒJ6` HPNXH 밲$r:F]’ 0$O ^NS_̋yͼ3M._u zi,F)\67<}پ?ugڶKpYYEcv焉4댛Onyn$my\/igo#>FLeݗ +ܻs>B]_^,7CEu7vVO}:+Gۅ޹ lbD%vv/'g[A[nS痸v#=W/ =ZjI,= DS7'$<lO/^]ؔ U$ï{ܗz^~{߽uz4_6>U|]_in=n^,řt 7.孀2u1 /[6拭!e.a!6DCF 6>SbmmǨ(id"9nEH+A>\G|-7(En:oG|-7o}˷?c!}_.{GJГ%?`^Rw'ŸJI=2Cn_En5Jn93m~'*. o$񞢍ُw6e}@?t{H?]{||!toA:ybUAOກfRI^܅ydִ/D{-rV+<>~r$x?=T2O{}5dz,r}nuJ,9<{ ~'6.n9Ym{2{'ƨ?6Y%}=;g6>dzწ'6ΓwgG9% !>k޹n9FڃvV-ȶPzu.7%l㻸d\ vW^co,v)^:qμe!UV}ĐȠՔ4ZgSoxS̰lpl{P.HT,$!%W7-ϻ|4`HCFA^x;ommݝ}퍷`1x6*1`K$hrOnn{Ow9yfIdsŝܖf>kn߳M6l8E4QQP={{{߽ueV]}ʾoA+{O׽)uN׺{^{{u׺^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽ug?vq^Ľ!_yGvK?S'o?'{ߗo]{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺G+O{>_b7ViFӠWЧ|^'^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽usq,)fJ,:z*:'*y0غ9d],сXA +I+5WF*G ^M?c;?urG1W[־\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/);~ewNH7jK׿\M^e3}{߿GqO]}_IoZ˛ܿ{h/믿Q9#ݫ-_^s5{A~M?c;?u'$%k.or>飸v_{Dcv$}{_S?׽4wt߿Lnd\g?ڿ7WL^_;/C_~rG1W[־rj/)Vkd*}}4U5rUQDURUϒ j$d7VGF `N^S## je AQ9m9pE*2+)r H ׽Ľ{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽twO?1X_]- Xٝc9Z*ekg Kq,"Fu>{l?7gW/b]Y_GKCACIO䞪U(Y(׺~׽ߺD^ߙ/?:s6X{ bo\,9]o.[k}ՌcUәaA54ȗGR}{TYtWg^{ﷷv0{j[lnl>3pŁReyj 5K=O==D.M H>{~k>-6#/r#q]5 lv y 5FV8tUb ߽to';șI6^>{9]ɈcudY`5&(\CM{^{u׺{^{9_Ks߽u2?ԟ3`:^>v= ̻{ 7w]NMW%X_ 6y4y׺~׽ߺ^~{߽u~׽ߺZS=R?_{'gzt]O;,mm>odi˱NqQB%[~-~/|>.U1{3ɾj<lP!o2iOu{^{{u׺{^{{u|fdU:ⅺ-zٛGv>ˍwW?Az~j;AbXX˞{}ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u*/0w~;ۧ`u,"+0b.C'PaV %{=DUK44GQMQ $3C,edXPAR.9~}~ _?$"z>\F=͹vn"uGkQUJYa`8{S׺9fk|8kb#k|ȵ#%Z5l͕@ꠐB@~V{^ _nG~7oYO-E 3=_^y*FU>*7{~|^_"?/ru wa>/tV O%ܻ%bJfPT}-XߺFY_-h3 ]aW'rfRup>{{u׺{^{{uR|Vãs{u"O˛*}/׺V{u׺{^{wsg&.}Y}Cl ص{ktn 1B|`[/{c x}fwo^lOQ>RE2[}{g?'QK׺u׺{^{{u׺{^{{u׺{^{{um#;_Ի۵zgptwiwN򖋯 N;(_ {Wqn|N,5#}{I i_0N؟-7sflprv"U&Fc h={4~&U,1'G7l}*2cg7.cpVi9,|TGbeU@ {u[JG#W$#ISY[[Y1y$j*jgMٿ$u\2k6OMS ?8oZINȖnq*@EuNJ||U񖶷W];{M<<v5t*憇7"9a{^vj*% ybbRK,U#4RYs׺_|7+~H5TT}&R,lZkOڟeIoP~ҋ *~P}[}ٱM썓QOO"Iٌ1awLpJ:{u 8~J2CweT~هp <Xӟ~*m͈ٻ`ϭߔ8 &I{suA LQJ܎זx|sH׺<{]* zw{_pm:ڬVmuPJWܿpddS .dz"xGuQS!ݒjMPQW>S.WpiK.ae "ѵV=X[s~lI_?!|Y=&׳ro~|l3SF9SE@J|;%YifIߺU A|D_}A߿{^s=sm䥆jzmf4y-C|0gu[I"߽u߽tfh˯n|?vn՗mvǭf^/I K4HƊK{^~b>tω؟-A?bf7]?DuVhhگiTvyr2%f }bf׺/} |~G|qꪢzut;[+gj$ػ*\hYVu5~et 0]I<t`؊i3;ksajo n6 zYF#[ߺUݿJ'[z{Nw۸*niSXJ|Y,F kڑ-{^{ s})w=O]YM;g~Ηi>f}\j5=*1ȚAtC?΍?WI|͛ojev|4{"7^f(%GtEJ}oS̀<7fEu5"] t6{c?:vٿ03f:·av|4{#& ׸ǶbA(;)NX{^Y/ 'ߺ[ug𥯌_>[j|~ݸۗ:=-󣨭w)ȖI~ _c3lϕ}ޟڛ!vSM,pX9IQ5T@J=ߺU-?7^SlQٿ%Xʩ7 1;*v&}[!c+Uh#-~ {|b~H|o*zs;[)gjd؛joSi)}~noC|]gcKw$8-σj*i ,&s3.L)i&RFu~$-˴h6#=V;fmLu<$)<-[r/o7&jius~j𸍟E*Oy]ʹ!o=B8jva1r;\܁s~ςO#~Qu6YմؼNo,gk.BUwo-w˧ɊBVCߺFgž(-ߔ۟`t'zv[WanZ?/-wOݘꅏ4/(̤~7 :OKIm S;/U}xh~3 >^voo>u]ձj:=Mc\eCcDPM7u{^̾U/<>Lػoqlw lƾf W3HXs{uo:=?[OzkNww[n,OYM"l6Apae3˸#h"Eҍkߺ[)/viu/Ntrv_r>˛dKck7&?m%8mmřUY?U=ߺW׺–zڊn{>.ӻ./~.c-~')4PH~P6{%\2 _>{|!K$X2c%qk-ߏ{^|J=ڿ'zg~#V"]+Ϫ/#gW  UUuN؛c:|N닇7cw6xv#7FF(䤈2߽uV/'Gu,]gשٜ emE33]<%=ߺG?C[k0:;YQyv(^ bjٔwPc(#M%CDQuD= ymr 6=DQ> PU,,Qk [_cvgTT^l<2 #~/*~0v6mOf +Yvv ~F@-^X%*e8l`ҝBߺ[a^ػKzv׻;3y\.knm(Ueuc {ߺK~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~O򦒃W2XM^^Ë\U!C; Ha͚{ߺWkjUW~an}E4bENݦI yz4˴XG>{V=??yk~9}7BY4K  uQƷQSHf?~_E|~f| aW޺n˧cvl@@ Q=ߺ[Hݾ> )(uGϰs EvtUWvgyb {^9@橛+~ٴDu[׮0 {K=ۆ5_5N{'ʯݐW >oMrOoՂȈ!Z]$U)k{ߺ_\^3!؊*W/]IciQR€5U2"K3=ߺ_t߅_!gэJqFwZut|Y,xnͳ%J↪WPP{^ 0_Sߗ>{|zcu~w8wzs|vw+s1cuL3²vCy#dT FHS)uEg_?o|>nI[]sb*6fuv%A8ׇr2*T2L[>{ߺ[|,yO.~5ߐ|~ٶT?۪=1ۉ߽|xEI{i>ձ©?.3^{/{^׺B¼[D'׺ǧG|C<ߺZ3>{wU=u؛f*6fuz%CxLUTYL5n?!C1vOKQo{^aFm_7{&_7WQ՟&zq&JLOvu6:bfVf ɴAd8Ҡҫy ׻?u痥?cy)C[gUC2RqtR!}ߺ_;O|쿒m:ni1]Ӹ6,r=YjGD@ UL#F~ /qׇ|a:b9Oqm]s[uQEFW[ -Wr *#c)CTGQ>հewgG퟈?%Ѳ0InwwN3Ly%l'z ^ lZjcZ ={2]Wn\mzS]]D3lbJ*(fZ8bLQF~oc{u^gήCsӔݩJnz]c3_$.{=CxnUK5UE~}n  >{/1/ZߺEgH|翺w{M{}޽>?`-Ѻv_lnZ\uL_:iVT< xCEMaT&(Tv/eI8Aj Ր5H Yg<>֓.>,vocn&ܑcjdd36ޮzR)X`JȚHk~o{w\|uy\7Oɷӥ)*dwZnJv&7_):{ߺ^~{߽u~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~ցc_W}B'.(&K}w[Y~ky ˇc4{{7O!xܦڴ -^G{^d[~x>.oyߎ[:ou\V:Rj`4o{^g?_C|j܁Xߝu1>_s@%@!{^iWgwObcvu?p,1\s%]4!HN  #qǽuT ?[dz}?wV<^ .CF+ٸ{^~Zȟw:S:?$>CJO%J͞g}tr.T{^I+1lfIb ږ*`qۃ+1LZGT6 q~}ߺ_-OYbt~L}tM.nлwz㩢eޚE*OwN#ՒSF#ag>{O{^{?{^ XFÃnu|[~8m˲je|oH|~.Ra~S%gߍ$;{߽u~k ÃQ{uD{ǿ{^ o_@,{^-?_9ۓM]ߍPDM?1uK G%dF[5}{{^ ژ=Tcqm/R" j133|M#?q㢪ߕ}*gb9'߽uBکWI`r&c\T{.[}ߺ_F/Qje{+|8JiXLWvvO6I2׺u?wv>>n|iꌮmiHjoDAo͑kݵNunOu`{?=|C/nARFb;{Stko}3Gv 0Qt%$L)qwT=DHFb}{vSwE-^D> wnO 8cynEt:yT׺{utuώz7vwծz: {R#%]f?lct E]<-tߺ_?~ۣH>k#ۚlݟ:=הw/ՠڛ1Pv-T$>{1/Zߺ[? on(2j϶Iћ+"F8F[뱠F NvC1+zZTW ߏ~ X%*HfB9b62H?=ߺ[#Ž8ۻ9}Z1w~)Wj% ̢n࢑߀ߺV~cK֝egVTE}_{oAX,7Yc!u38~}ߺ_-OYbt~.쁥gc$NotYA|f2iv/6 u~{߽u~}v+㟈p|~֔.UuGMCI<@9. E~- @uu~~j DRQO[_ &F/Vvmk9c:*l4mc:׺H{uM2?1{+p{uKau{sKt~ּ?~78;}ߺ_a~3Sv?P{u{ʿfP_EPfʨ?)6O{^׺ׇOn9s ~|}ߺ_~o޿:'tY?~Gh_>{{^@?\/g߽u&_ߍGf~{}ֹNI=6Z7^~eY<_Pw'\v*}BxXǿ{^׺[%ߔ;[_ۻo'KRtn.h|?huw>O -m4RjTvub@rI<{^yDퟕ'zl6genxM'[G)qcw&:h\n+0) ~mc{u~|eA_ ھ{?=©.<".dzi~^{,J8?3O~Hݡ#*{x; WXo[{^e?D/GdS>2KROwSD{oz4* _{^q׺P5!V:Z:L~:95SC%:-h'߽u~}Qf/Y|I6?q>/uNWp*#0b3m|"cw q,M{^?K:?~o%?}G{^w~˓{o^R߽tT{"*u~{{u׺{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~oy`lװf>,k;w.*~a`7&. ,j[$m ׺K<ϐuyNnM,^#W]-l/-YIR{^f))ZD^VvZz**xQ( {^ oy/h3:sHUd5*eȩ YoJ:"ܧ{^}ߺ_m󋣡"+h<~!I7Y !6.Y {񩫪tH#i'xh㤣G$@{u_'ݙ AXW7'뭋fau;%FAuK~|?f}a߽tRξDƯ~ӳ߽u~߽uێ~#Cg}ߺD_Eji8WG%fޟe7%^2+,eغ쬃\ O~|ٜbYJ3aq|6cUv3+QKf?%&x]%TVV ~mkz;:WBMۻe|}],TyAwC)y_׺?./ݝ d]8Lٸj.Ml*kr/7碉Z!ˬ ,K&׺O~㩿U#7߽u߽to\.S?~ҳ߽u.swΏ׺ׇ/o#v3wO{^5׺wwo~ZU^Gm>^ᒠa]OkNR(pԻ&4d5ٚX*~hgdW?-1~ n:stw#!E?`osY\XoRee &uR}{VSێ~\gߺ_"_~߽ux䷯ O߽twZ?1W_Ͽ{^9׺9tG~k |Ã߽unڝ׻7*콙:y fvWmŊD9>JhZ߇>{4^>]v_>d2OO~Ts7PQM%n>1Nx*뀓~_ʳ|R[s}ԛ)#)2Ng)᠋wa$ep͟´_CR!(R)/{^ɾw²G},^}ńMޙ܂AYi"ʼo㎶4gWu=y8 .{z.ػk0X j1Yv)*(j*u1Q?ɿ=ߺ[{uJàpvVKY_|[ :6Hh+{{}|>u53S%Qwu:t8w7gnTM}PaUv/X_M^eEh{𿔇)k6Yߋo;m7k7wX=KScڃzTdx#E5~Vr$c_nޗM~Fl]A-nݽ=mc(2#[]&<3_׺|RQ >L|wl+qԵTsoqb"576z$YKuX඲:$o^ΤF{OHZ:-ղwO}4>nJtL}ߺZ8_nI0nֹ[tg{J]m"mУ N۫zm<7x}[!E4XW5蝽U"$Y]a.8lNidx斂*{^qE$QDqƪ(TDEQ@`=ߺ_ob_uC,=ߺ[u\zWu{"ޛߟW߽uۿz3w^zXu`inR5]W#~|V7Oe{pg7Wϙ5YO5SC?=Z릥hTXe<X* {u𙾽Wu);{Qnluk7d涧V ]8%^mw,kN%> UO{^`~׽ߺ^~{߽u~׽^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺZU~\Fw7R-c쭹rf=X c34O3nZdĎs! ߺD""\_/?A {^tp{i퍓hv]: bq4Q4߽t~k/ο1?Mywnu޻WdϷ.y<6Rc`-NvJ_>P:(- {ߺU@E|DwY{^qNۣͧsL+au>jou0׺{QތQ!Ȏ}1zͽ0;?7_4hk#g_Au~{߽uSe>{?M~uí77c^߼(X}[R XւtIOAhRޢ}ߺG߽uK3GsVUe&ۜmm3ur4l[},5uKU.Q[;$}{ֿ%6_F|%J.Ԣuà"8?e.c95F:sYS׺ J?/;|,#%6fmMǺфݿn{/Wݻ14y\emJ>B Cuk덋}g޳s.nRF,Yݜtl< jrI{^iSa185IQc)C G(߽uILS[򯱾HwWJ탳 mVK[:{ߺAkuO[[^N]en8-Áb,l̉,N:ߺZP|Ltym靫;{W0KS!}[+<0|tdq:5l{Ew{7'U.Jm>{'Mɾví77\m^Ю5߳Y }[_5kO/IXb=ߺZ_?5>G_C׺ݷ߽u'D|~h+r+qu썙%ڻ+ol=EQEI[VvZSXRt8~ WO2}T}uPb(.?s&F]O DoQXJhb~{~ROHEsJ?˗]c-K}_Ok5׺"z|韘wv]mlJ }׻j#W# Pj#0&XI>{ߺD3S\t}A5MvյvzllTQ6cbV7tZ1%=jDE< }{dw"&[pO(~XlͿQ;L6Z~ѣ3RPfvib,_qLGI׺_ X_wa{ciuNk7Cf/om>JYhM/@ѩp!ʯVJ5w~~L*(دM׻OqPL ) ΢׺9LO@YL.R~_;)[daza:nPngWvN禟kCE_Yժߺ[N{uatSiGĎuU9L蘰MכnKeG|~jg׺!ϱʼ{k쌆 uyύ>U 7>urh8U(o׺=?:?ܿ,~IvV g?,U>7r͎9qKlfsPkQt~m]+ԟ:ktFuꎮTvJ-#PK[_W+UTdI%wvu~֥?2?$_>e|o{\_:4eNJ礀%u[@'έOq=oݻrw {r;qU0c۰ Fi`=ߺW׺7r:ۿ&;3GnuN۝?:z p7)}ӾwU>^j4ի3D \{^wtW~Hu^{s~`v~/EܛﭷFnoCZ*j޵S!#P_~g*/_׻0뿎zD,K3:ϯ4Rҿv/ߺ_-υ7Oߖ>,l﹋5}6XD9\'vb*~ӆ+QkAF}{v[v.]l[scl +IOGU<|v' (?Ԡ~+=ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽t@?mY=;ch[7ozVl׀Uac{uww-C,si*igX0߽uq d1xṋr斣}@*SػE8y]M KP_ug;fT?ˍE)X*wmMk#iZ/Gbr' c ĵue*'xE1՘||.ݣCSN5B6M~RU)^**dH`H{)]N쌾^H([٘g?b.Uб%ECGi{ߺ_Qo~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~|@q-SכOJwIo|=-ǟTnU^?nz(jrxJVVdh׺_]E7&e=E=R=P;XM.}{d𭟘5wt/AFqۛ7Nmö20=Snv {b6~?C4W}d'G_fQ7u/Ktj|M=%ڝ({jesYz!UnPQQWYQ$T4IQQ$P$~}g,ρ]%R ~kz`1øN1_Opz2 4Xl5Cņ$QM&#JeE_{^ʽߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽uH?Ο2㶯Bllɽi;\`&[pBLڃKQf3 P}{k07ZQo.۝vg~{zCoZlu͓Ĥ(ÖUOuG{^{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽twEuOɾ^[}o wU,3Fro%cONRUA~6fgn.+Sٜl+r4%xаgP}{k߽u~׽ߺ^~QO$.qؙGju =lnW9I0ԘM١@Spֿk埭 , ^ꄓ?MO#"mPǑ}{W:[%Vu@ʼ"ܻ{r9[Hؗ۟{^h?,\E\zj38=׾|w& 1GRAόRqS r3JߺVo׺{^{{u׺{^{{u׺{^{{u׺`;kllGu]˷~}ɺs8C5D4ˑei11KUQJȡuQߺ@w9*~7=ߺF& :"9iex pJA{^?{^{{u׺{^{{u׺^~׽ߺ^~{߽uG(/|O=]]ۻ%K%Y>GKm}χƶ*į M<Ļ.O{^g+ʿ?~4gO {vSewnˬu|i|iܦ#|W`MO+Y}{}ߺ]3*+30UPY 169>{_f־Y#qqgs1[vcvo5Yڏl}.ezRPO! 0FWm`={{ _m~16~4[-oXUsdqy*?Qa^yiKWR2{^OsC$sC4i,R$R"HBUu ~?~֌?kϿz'@N 7_ax򻥶NoZbonn25XE׺/OwQj>Mn~:2d7>߲ntɚ--BJ#Nui${u^vh濷p;wķĞl^;jm$ME u0@ {uFOhvfb#ӱ7)ݕѻ;ӡҲ LB H$/f ߺ_J/~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ_.OY{H:O~҃SoMP׺}u׺{^7;?7h|.=;$Q`n}۪+m rt{ )4RHu/ZW߿vFӬZtnjijsiy,lw*ɩJ~߽u~׽ߺ^~{߽u~׽ߺ^~|l[?[#}=Ka|#|ۇJWQSӬbͭs׺OKpv?p[r0?" 7⪚glS5N;#B!d:$@׺u׺{^{{u׺R+{ǫߺ_o~c.?֟}ߺC{^{{u׺{^{{u׺^~׽ߺ^~{߽u,;/cVxY]^Zz^T1"Q>ܬ ?SzAeu^ywXo{JwW^o vhG6j?2?>KA=ߺ_xݝC}ʹ^}fQ"$lbVA2: {~Kj}pVoNǶ+v^ !˾3^m׺:|^bito7]72Fg$jar=ߺM5fFz:6gx6GRV~WD|fb髿O.n܇k7_;r$4id RK!H'߽t&mݛ^\ 6|Nr"J*g>{gN g;ø+I){yfwdd Fo*} {u?AuGٽ9APw/Q ׺t~ğu>{{u׺{^{{u׺{^>u)߁?̣-#Sۙ>n\VwFwT YoPT`)5bx@׺>(!oWvO:>ڻ^cAcf;{}v3tQb2#)"up^{{u׺{^{{unJ^~߽u2 x_~׺{^{{u׺{^{{u^~׽ߺ^~{߽tTttsZȩ䓻3z -QA;ugvF '$ (fOufJ#ꨫi&zzJ%Uydt`XEǿ{^ ?h5mwN*Bw^G&61zҷ(^a:׺~fS|_}۽A$D{ f']eLTu+{wQCC7MvvؠXpQlɳijL~ߔ}1rn{^}OFJWyrFo7dhg0 MJ- k{^@?"?eO97-ww_QT1⭗/y|gPK.1؜&R$i{^mv{}ͱ6>\[ v*yYÒb1̵ _o~ݣ?I`~5|tcz:41#k&AԀQ8NH|%߻; tn6^۸M=#.ܙuj ^^*fX*e6{^o׺=Tr;_~|GYuZOg7=)*dldPgq=*}y%-/= M-Gu#>Bvwo]jspU;3Lr%-C],I&uj…Wm.C1hxw*mcztnITI(J1mTCVt>oϯ]{>g {[rϰ;Wbg'\nlVm #e׺ޏI'L-~#{;|>hvfo-[kcZnQ緎W1e31R站CHߺWK7@|9eyI'sczJڭoջymMAapu4 W IN]Rh_{^#c6#stҔ+]=xpLI4TN $~d~TAOwEwie+WUv4t_S8̲IEuGM~n>{^vC{OvgTP2ao+F|2⿆;juG_{^^6R>YՔWAw>>#OoUiػPؙRQE$E<~g__- v&l>|7xm\~sM׶~vۙT<.{X禨$~||{u׺oC [u՟>^-so|zvQw݁tEP!hwVhڮJbuߛ=.޽tTNjܛMR]eeUy 'fbK ~{V_?Ӵv>+v\atoj̖4qWdzs_|E+I5-=TxJɉJWԳC~}m:vzg\OWgO[w t37=Hji*1їEYa{={߽u~׽ߺZj©׹>4I v6>tvWm}æ'Tƽ\;,dRVTvP={7̯?V.V7}oDŋCSQ1:b] Wpx~m-S):/vE0|ǽ3XU[!6N*-ebN$Aj4hɧ45~~*yc IYaT5| {]aY: 놤g(^khehuw6*G{^?(Onog0;ѝݣvbu2쯸MݜX=3ojk3-NY'{^>l:QyfqmUu2b[6:omc.*fm*nҿ;6[*%SuZ|5;yu~-GRaڙuGkz&ryY!~я9 Y|/nwUz~6vXF{6 _]&cLM {9E#tV|%EULpov[ܘ8{l | TSꧪ"׺w7/"wnOje=sSX1ٙ1l|!KI FG{ߺCo>,Fx*kzrn]Og^uM PSCI L׺7l_ 7ܛ|a>)lMPf6co/͒>I壒JN*={T{"*u~{{u׺ԇ}n^;߽u4E?`W~}}ߺ^~{߽uo}Jl'Wu~oM[;=KTUci7TyJ:ad奨 ~|~N51GuW;y_5 3;;U)XUy;ì@*a~!s8~Lt^/f;۴1?E1y<_3^>{?/*/Sf/YfϏ'!}-=t[ML{?$ 9 $ QUՈo{^EGYGc+頬*::zjJᨦ{^EX_' >>P-u;}.纲=Negf*1Pj B{1}.gxa]g6{C'k͕ syr_s!&+52#,{ߺ_Q_~֏S;{hwș1z??bb񝛷q[WpmEatun:zHFV7O{^f?G*1=M|o~)&~-rA8Ms\КM&&iunJ^~߽u=E.=wvw&`;x]"&o2d\bŚ,L1DM~k;q>]ۙ%Atf'yewlF|vf|Tb]Wߺ[&R˿DZznoߑ .kgf:{εyj=mʚm] RCI -SBߺ_VlN[c3L[ e\uDU3#MeBx*i&I"׺p~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~ |ee;|<Q6zv$YAmQP8GǺ\'߽u"?l?5ݽmgZMFw~;85mcR/m"j_ 1Q\`vz.vyTGӕ 2G\kH߽t(?|k!]E8ތdGxwy8*kU|59S׺E~> ?mҋmђgC[^&0I(ЏUmozn~* 0EI&;or5 p1cQ׺[?ȏ*yjy?vM;Ev-A4>.OߺZq>3?~`+}xd>Fn?444Nj)%5of`h7Iu^{',?P:k{n~ y/_Q=ߺ[…>a>)]a;+~`ֹ:Yږ'UG; |VXE{ߺ_/~$ώ?˫T]ԛ3w;;^ܛO[f}K>\e3 4ݿƏuvW6-ٌC/o})?hi9޻yҋ/yvb/{^E0,-ESk<}d/OYAJZ*$ $412:0YH<~kn_߽u~u6?+z/-by*h+0[HafhwUv@o׺!?\o G?Gq }v3=DUȝǖڑ2+=ރ 0pXߺVuAO56n %\/Y#WHfsC:jVVX\׺x¹~ |z~k؛%66TͿKV#/UMMP͐+橙׺UW:m~;;Fظ3.h0 ߺ[6/u,{7{^ ;KEɾNuٛr7m]a競_9*1U{r6B *y_Az'Gu|mL:}MԛӦ= p5-⧑i멖JJ楚X_׺g-9G csMVMA]NHjea׺Q;S5{1YʹkNPpXjI0ӡ:ZxzT{u@~{߽u~SN7}uɿmݕ;/߹ ${) m-e=K7 ՃHE:7z.2(ҏiuۻnSO;oi~ I,Ē}ߺEO?>z|z#nm`3H;Ǭ&Foշ-p5*e5XZi%{9 wF4[7rOLJf`rU8Ƨ/TRB@uҿSs]>㭛'c5d)[3Tm6w<1uI|ڿߺZ|8ɼ~f?xw?z~\WK1cpnX9jqGnW;H}D{u /ӻo8t-&;rozͿvWe#Xr[ ٬t֎SAOKPG~i5 "\=ґ|ts1;ptyc^n$۵[߯wLE5. .7n穲?6J423u7]#<~':۰Ks;Ƕc=n,kuHE{^1]ѽFomedd]ٛTlWg0D,SƑUPu$9N,&3֛cw;e|f Cv~ 64x*=0VbL,ST>/?/E]w*q|v5r@tC93!ᚒU1O,/~|ggm~h|3> ټ}`tsWMN"O;zu"ޛߟW߽u~{߽u~֤?uWuߐ{H/IzO{^S׺{^C!Edachr#*glOA>{ y>x|wV۝j$v]q {B*},v݉u?->tm׻st;S1{qh^m$_k6ekiɲbYd׺C^U>Cu펮ޘvwi\3Xa-vp_-JZz YUW/Gί!YjfpO/uZM|(i/9mEXDBG 鷿{^ vk_V-ە7>6n]wpdfijjqq9M-%]ILe4eɻ={wq5?o#{^?+?o#{ < >HM.SzO}o KZY|^k&_|ex>ïs]7&;1;vg2ۗr2Ves;_Q2u!I<1,9c~}81CJ7_]GMRvzl5W[,^n70fqĕt0Ȑ+Tߺ[ZJn[C1[[A;#p}yץxwQ#iA_j'H_׺|mo?woo>M{`d6FmRb6'6+YH%4$Ou!-??~?rW0:W{u8{&+}OQziv_ɯ8*nع=ۚ4?\Aٚj fޛoÜEW}J*"cS~ZZw }]_zwb?gm]}Ct`0{r=S\^[-,ԕ&AAM,^Ƌ߽ux@O᫖)Gєvsfj>1M≮vb]߽up{{u׺{^{{^~׽ߺ^~{߽u~{_^bqRvoYUhUnޛ:|L{ y(b~]M4{|A36ew>Ijt&bI$Jj01vҎHɳTW^P@,$ ׺KJ߼K=yE&٘Mh_HfA{^rFm;r>#5p^ìR=O=@Kb}{-@^ C9"9:;`wN`s@%}v:MuP}{-= ?pqwMoᷗlGgRT18^Ī.?ro LB$t~X,#G\l Tl7ޅ^O%4[}GM^o%$MH ߽ueul0b-Biw {voiQJ(bRo׺{uXO{@{߽t/(%G~^-J%xiZT֑e{gof__cѧӦ߽uYZ۪õg~Zgpy5Fߡ~ck1q}SHɐ"drRUWRQ}{ߺ_07ٿ)%Or='Y\ϟ)T؍I*JjY2)NZQ4/ox7lb8_poN$sRjv.8Cr @~oԨO7MU먠쮨FC1n$Fy:_xc}ǜ|9t{ߺWSߗ{gbY2P׺{uGm\dU|A,q+d7nSM#9}ߺV׺A|8>P% =1DH=Ĉ6U{uOs?-v~m=׺{^{7N+#8ٽa>?Gn 7lV)rX-pfԧ'礦XuW뽃Pljo?6wTF+ܝCԧwn՗JN2>1~|w%dc_g8?#>(U79G/y vr7{usrܾ{in Um|Wn蒦)2J*Tii$R}{g'1BYn%H`;{Qu ~j }%?{u濝j̄ _o#_??/~؋_cb _~^IDcZ-]^1n\>{{^ Ӧ%_q`"sT *Sgk f-1S?"MW߽uu~{O,:Iߚ SInMm'S3u5|axuEO7?@;O+⯿{^׺{^{Hg?!}ߺ_3N_x~ާ߽u~^Y|,}™1Cw1-"UF힀U$a D׺T{uGjcv-El-;kRmjlu4;~mS JBiJ:ӄ}ߺJ?O\ߺ@>2[˰z6Hsym>*h(it'%We+6xR5*~}k}wvς:uVm窛ruN#)UC^FХI5UAu./f;z>~S%gߍ$;{߽u*.%M~m5C!M\ڟ ZA>)r_߽u~}> wik_MJT6DK1(J;ǢiߺF߽u?;iy4z_u快ɫW{ kg?qQu.!ے{׿z߽u~}>'mvh?DOPP#T ߽t#NҦG\x%clpCR(S; ֔TyYLN$jU#׺f|NL?GbJްDvnjP$QKZ%4VG~#ô}=ݛ};y s}2۷*ZŠk]׺A'+)5̾7f~v^<`Ҳ xw+1߽tv?٠T?; Yz6䞷xMCH,J7.å5KO{^~w߻^dnl۵}T9ݵ+K+jQFO߽tbv||cNJ;|oFdS-]*j#fyІΧKk{^} op5~?~ W~Kn{/,[Q?v?>^{',?P:k{n~ y/_Q=ߺ[kž~/>O'PmLdٍй S lwW'P ibp Xa׺u{՛~4g7o86-Gۛ+SM6zjX B%ZjX$^??˱s=w_,bz3NzeFzMwnUTmy '_^;R4 ߺ_\K!Օ9V%VL 䪬BOSUQ+;Iu_uWsv{~iۯtdDl쌵qMc'ضCuwvG3T5oQLmK׺jhܟ̗]ٮ9܂!ۋgCZ?wyUL&t:6_h~ٺwl؛Xz8~j }%?{ugoF!?_~߽֯u-[eY߽uY_?C~}=ݱә`g7Y|x[""TI*M{ghu. T=uM{/;_7:Mj-2H׺3<_Yf'9(^ߙz(6J{~es9 (qiG׺S{o#7ow&]k[ WJ|>MRVTF+0z"WD>ū_-I|(6VԘNe]ꭁl]khuḪgomry dgH5;u{SoMP׺}u׺{^RYx:|_~̿'zh+bQQ<A,K!X(Գ3 ~ܻ/rd~{ec_^߽t^w}ݣTEbLg[or'3Pդ&]_/~|:~Y|r>LwNƤ۳rrTS0Sr-msF'C*'E%X~ӋԺ>7 fʤ)s;r5[oES"˟vdtxlt4!i={}ߺE?? 6 Of|-ɼsßrR/gPn,E mQPO~ Q{W:{bU;u]}꭫;t}GU͈B<׺ 3Sv?P{uoj? ׺h6?oooBM؝"lcߝs?oXO& }{KR cq4׺'v|&}{SrAM$Qc{qd7،a#aRQl"4߽u!-??~?rW0:W{u8{ǯ]?u2/2^{?{^3 wMW{^ߺ^~{߽u~׽ߺ^^~׽ߺ^~{߽u~M]CAtort6@O:rlamLʺ+Yy9~~Wmޝw6 vn=ٙlf/r% P~ ~'0>/[,gqSzl^wNFZQizg(XG{^QC 541SAi0C (UU,=ߺXh5̍,%E }Tk55e\/OUKQ QH>{7ۺ. bNmFZ)dJL.fVe)U u]ڽg[_dSvg\mQ+N3qv Ƒ2H-{WTήnٔe`tZQ~ml}*]1~,n=ߺK~ˏ#7Fk>Ncpq2o^gKM,BDW߽t.-615YSKvFS$"’c(7߽u}~#/AGe([tgke+ԝYs i؍ق@~jayji$UGSM~| om;Ӯrfh7_VN"eJl.e6jjgUu!R u4_9(>R|2w_|7hwbUoY-wkⲹ @E*aA됀5{^0?7ݟ{y|q%;缫M#n\WKH';[5fg}r4UY䞆A-,Vi{ ';Cf6Rn~my 6NKՃs$o=E4Pn H{uj]2ZJH& 'o0A jK40UU_߽u/Gxgߺ_kMSE%e'$UG7*lmco~{{uSSIW5TPOSMQOOQO:4SA<2G43FYXe$o~ɓ{>I/NNnݝgtgrf=nGUSW_v/f[Fo3!d*ז?{^꓾<|&'?}Pa:ٺ Lgna,B("TI)iV~դ|\/wݝ;zM&Bw'hZu_zgn⌥K⎥5CH^?{^꽾|Pk6ruN|ɲ8_!Q׻W+bWeRi-Bߺ_QKmt#+E]mȌu.Fz:79 14k/1O㕱~ֵ𶝷# Kfim<7̚N~Y(k6J*vv6?C?"\7)s(L>b}]hij{wjySip=ԽvX2 vV@d1,T~ vv7]t<5uM4,}ߺC?kTu6?:uSjFß;8U R4~S'9θ ״uR,{Dz0I!:kwYSR"~ڃg]nq3;~uo~퇊)+wlڻgrcck1s8ɢM,׺7w0YSlKPج]vA`i7QfaH k׺KNݸy&)65fC IQQK(d­Ȼ'߽u~|@?N/a|[>}onŷzML=?vm}ՐZڭL)LU$OA~i1>8|m>N}gjZ:{}ORѽMW|-ۙݓ9 _6wbboq3wEjZGWԡ|o'ucTմuUUCE-U4MSO2 !xc`Jo~79? Zl SmLʍŴހ,Szw^zM.ڂYkp]ke\G!\05%3Y<0u񩮭d5Sd2UյRUr5U3ZIFwv%'~{S='A[{>~v7q|ʨZ^ϸm-m,TQi:`aPUtuz{zGJ%./vNi% $x(.3'M j* uKtMPc:Ϫq65TcsZ\߽t&{u׺{^{{u׺{^{{u׺{^{7qV{|zX3ҝkܯV_j;]g5Ajeի߽t`)))h)ihi訨iibH*"-׺׺{^{{u׺{^{{u׺{'娆/{V%zeo [>),Q-͕H{^7U&.\'T_wI&uۛ/3 mn6GX% ׺=ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽tɸvt`k%vqbh3xSuZnJAB=ߺE_ )Š{j /8~?u4y ga'ަZac}W׺28\m)0w#pL^2+RPP-z흁+ kGKm4&Kɏ,87?cH{OvGuNK=Xc7 =JBd9\`pCT?O~qxwݣ"3gwiFo+Sl5{^h? hmwXw(yy69[ ?Ns;ODS̲SW5^OalMg]N=0[/em<*Qav8l6Mb$҈>{g{^{{u׺{^{{u׺{^{{u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺAV螐}7['#%hpCz̮"0q׺Wmm65 쭣6~13cYXbi)).cu{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{{u׺{^{xtQuo\Ao w,i&c+d^~8m랽Xv;ƙWn L-.߽t~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^w_'3uznߴʜe`,=S+k&-ouݳvۻUY'Yŵs! (ҕϬo{msvmy~4wB4D`׽Oe3܆ܹ֛_IPd1;3M.5EYs)Rmc:}~iwڭkeF0D%2kʮFA}m/m{ܷ(EUx#5hGm2jJ)SuOxb$,HH_YH#R`#]nN {I}Eѽ:bgm#'05X7ZX8%e!{_nt~JDMw$,:IU]#[\\|uX:5V**zMҸ#z3v]MQ'RCXM$JpE}篼{폵ϻuW7m"G&DJ1^(ue~r%^Ioi\H—@#w&LvZ|;UܻWw 1 L{S^f2J4j477vG5{\<~ef3$-JϟY=S^qo!Õ"Tj8A=s{xvF5{3{RjJ-VSVSO5UC"Te(tzW2{윭c \3N+ Z=*# Es^n=`޷~c`U#`IJj:5S^R~|\۟Cckn|mMS3ȼY皝"ShR<ngk[䗓bXjMsO׶;w^n׹whJ\T(^){k_+_cGefh'B2CI_ MT<њZjXdFeiaR/'w=-_r  _R*$#  #!ϱwk{+kW 5\k 7`(RDR ,|;{|KGnSZ,P,5IG )=2Z_{qtϵ.Y׵'X9[n<ž]S,DTW#g{"?#FtO{Okcl?˹7./ß5%|aWS]~DoWK#g7kAwÛF/Aa S 1`6#Ɋ8d*qKzTK75&mRoۿB0S5̩ z$ g 3J-]t/0f;%W%QIVuco_ו紩v]WgCvٜt`FBl8*̍1;gq"FV{uo/,2im3*=<4|:Yhn_scc@!LR[WJunvVcܝn Z?.7):--dz\T\\}=-{)NvdC,fe9W>տ;6es"KA^{_Oޕ;vjlCfN*%2}ĿRX[<>{ϞI;[6{<)ک#wO{ijx.Pݿz[B} Z^n׺{^{{u׺{^{{u-uv;sl:o FڢVK_.o#G"$pe)bK_|liI\E"D`W KkK}۽9wl¨ŌCki^oH_r~~q[ ?@o~r]{NJtP{G鍙7NϬڛ?snZjJ.Jz) 48aJPWsKcoov[TK*XUPEݟaxsyml) 16p hJ4֎׽ߺ^~{߽u~׽ߺ^~{߽u~׽n^0>DP}[g䩢[쭥U1,YLVGqIEQ#P g?l.vefrik[HC"ᢧww=`$PsqKhtyJVJyd1׽ߺ^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮȎ?Sڻ^Zu]Y h_S.W%&2IZD>=~ck*֗mQ˩5~ĪV{k$S<7ӳRnrI?Qs ˆ{zf|etMO[ckڋ!AWQȄ]]H>!ܶ Iju#YH`GA]Xn2X^^A1DaFGF2 ":?GOBurpuݏ{JkX_?Wpw_WC$>{Kma(Q;1=tSõ^{{(Yw#K4;>d<B׽>J|,o؛K;r͛)3ͻKjPaj(g;!q01O/m>r^dݴQM,FWVp"B C0~{vZ[n3Colq@D *,A$3Pu T=K|}yYvnCiϓ+<;>B Fb ne۽gh9f}˙G$8 Y>:oח]ۜ7 ^y h(S.RD*={'{ubOW&o|W=oBK%\{T<~.uWsvY[_z7~̠צ%u}ci+5K"Ps.zEٷkwtH lQxutI4F}z~T>MnqvYvwK[uv ^G|S *ITSE$37y| c)bt2I2AGoq:Kܬ) zA:w>chAܯH #{/l6_qe /!f1x|>&!dJj,~>9j+j$X5gw`$/+qo6Id`ƈ ; f$$.,-i# 3P $uwo&PvH TCS{†9:nۻ~)S"~n }mX&*g2-wi,g~o0_w0l"!$Q)pm$׽?; S~}\y(.:-þR4*>K'rۜڭApʕNG8 dz|(s79.9S,+S nSQ5_VQQoL^v^鶪go޲R,2+IOYCY0<027+O.ŷ7*nlWI)j tp s.or2mr6ϦHe9R9e.l-mw1̐1pc$i"uO:)^f۹gvn.,<*^Y Ck„|7}鷻~*(yN.sU5 /Jz#ʺoc{^|]mI,N4:P`u0{i>s9#b獿-BÚHNI}{۟Əxo݂M]SRv3nMḱI >W`bqj̅=D2Ȱ^9]/Om-ƊfJ[BAhZ匝2tFKVESܿA2D\L%[p%Ge!h*ן vuo/ý'͇biWky7;=5,UK4J%Ny w-9F~_K%ԭݲ3/„#Ru=:rwr3þ<]geQS்p]D !%edfGR+XA} 0 A ׽O?;߿.7dI/T4Xmۺy})zzhޒ\.&iJF#{]^V[9q-"GoU`$e!q+ '[l|PPR;~NoovO,ۋȣ?jo-, {{GKk@g:k#^Z^ړl菷={gIv_ǎuWmm9$<#LRep(=p6(dGEG!s*w8rf{:XhCFaUec\1_5k[U$2RHU^7VSN у{L-{؟;wOf߉}QPa79I9i1%3AOpQy?ۖ}X9h;+];,#,1\T%L4w'0C3̶wvS#%W ,%"H/iΪٽ:&&VItBJV8Ako9o0y<t}0 "qJ B{~NglFڷAeܮOk_QO>X=wmߚ ޛrwTnͱzEG];kbwM=YxOMMXi] [Y~]i=b]lR`ݗP>Y,3J\}o?eymٮYpi$ qZLuf O쟆@Oc[&RdVn'S Y% S!\cK ~}}9[.vnICpRxI &5+D%|AO,9Q^n9J@5\RAz_q]Æ[Cܻp)8,%d$SQPP%EMDlT_>vݶlwM&YpƊ*y3fn{Nc-q HK#UUO{t儣kޛ:X%Ofna04e`U`@eݹwu7ݺ[MB*taA"RT}>+N]vf3rLNk+fZӊiQ:Fx+NLyJm;$/ Y% 9P0O 0}׹nT潫ؤ+1hB8I;`llN;=b;+Rwnݯl]%jvZ8c SZ-6Ǚ+nO"L.;$*AƒRs6nVo{d׌C5ԱH<M7@4`E@>]{8c!:|[7٭J2r ~Ai*kI@{'܃yo=9w=Wna+Kxs+j*hz0oܳ˛߹ DIX"e}-AQZg{ש?~noVۃO#DձabclroIO!xO U{KPScr<{Ϝ˱rPcS]GiYw׈x#>"xRQ{ٜ\.o):lm]PW.No$JAAIvO#tЫK#,h"l>{5w;.\N 4X+ȱEp\ȩYnn+g "YIEX"fv$P]PO^%wo/[.LkqzM>W6Ư4ۗxmݤQo̎砪cmmO(VIgߏfg݋M6wݠ-QCZP{=ݽyxy6c&k!nec˪jLVh͡ޛk6o OKbVNmqSQySI{g}y/qXHV6q@7jck>#seL9VufRNLej'o.xw6ڽv_Kr n8\G6 S%BӤfGd%OH7)'",_^C#Ƒ4HB$jDvS(zh>{8_0˳:,")wH 1Z{tYd:2:S+n-ZE+0e%j8zOG7zn^; 6=VT:ܻ)ڞjR5Fa%}GB6g;'W%6w׫;, FNjXʊy\u?t_#e՝B8UvBN |zbG^~{߽u~׽ߺ^~{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮU+2~I|Zݹ/~׆P,|TER!6"皬\17OcwfF^Xb4iy1Ox=vٺj8KA\EQC_{._' 1 Ճ-#|HĢdR׹ܡ u9y?CQo:yODw>mVvMZ;䧉_!Q,׽E?~R޿2_}\trҚ8zAƏ>+?>]sWi/?m絿Ľ{_"ǭaNp?{fu3Cv )b)ֻSIͩ6OlwrNhKiy[D(^y#Or6 du_po~]{?rfB~UWwjjpz sj{#?,> Am]{ò(l(&fv*^7vb (csYkvcvwxk_ܭ wI∲kX5TW=ڽma_4C:N.I$ )A :Wn\_>;o-o.[in*o曱:?dc4NK!?[v\tY,~ާ'mmIEFF35I9hXeHCfeGĂ4f!O Q$21F?z vKmÙ٢͝VtJ Ap#3G* E =7/[?c{ SF{vV3GO̢`m貰4FMNd;r:Oܟzvv6;}SY\F&n d4<0q;9}hݶͻxdWp:qwP0p5)~%<:tsuYÙYb%6⎚]0uTgz:-Ӷ񠖪aMMWCNijN~ s y脶o;kx~17痿t o6t=kW sm* ~3${H==!{{دɿ4:w;1Uj?[пgW'[|ۗm=KKҮ<}oᔹ-DžIyD-=柼>n{5`?wKq2A(WJ) 顧Yg.{n[t~c-D FYu Zd?;EzC2;MuWa}k_ު]o{Y/?o#I. ?}Mn|]t17BŀU$RA|?tnI =;ZO`ᨹ% @$^M-w?h|n51,g.Kwa-RSEIO"ܬ9 *}?1m<^tA+^42Cӌm2#Ƅu}-ϙܭImm**YĢb1ƄpYd{ؽptec>8ta7rvNAI.zav tZ(H9D7yni][BeTZB$nLj#vevd1~?xnc됷3c'|Ͼ;G15̉oT>Dx*I% >R7}/w=u[F 1 ,$btv`5M%H{<c#zm9&9$I{rJZ2 WT^b}z{_stͰoVd#]*L~oK{e]h8 È9|;<|g{i[?YuGn]utS܇^NWuQŤeGmǶ*1]\{|qrt-GhX U0U:K31V%7/[{|v]r7[&O;%OIt,,u *Hѳ- ԧH=vs˚o`}AYqJtտuyZI讣J$oY k/lm"ڙd_XDf{Gn}[O }weKnViԴ)[d7߿}.|V~6O4Zr[;(ΈTt}ng7]_mlHIJOjJ)O^?;?)Qn՗r&- Q׉j7\@M:εţW{iVI LJ&,~o>{ysr_3\mw3iVo[Ҕ^I ;#|ؽ+vܝ%n,Rc j qºPzczܿ_urc]q1Bjj$;ze{߼O s12]W;&Y^~ր "*u{=?"Lu{5g߇O׽_oT;?O_( SD>*l677r@:̼9$M2G 51+țҭFxQ,J$ƨʺ7|s{q[E]_IEbI&8$ǥٕJ?S3^=v^6ܫM>ڻWC.v("aPCVj$X)"Lm>{qGnQI. Pٝcr"$RìJ= ѬPGg+;>m&A FG.Y5sVUǏoda|iwܴu+iHMY'UzSbɲ+acCrcd{UcQ,2p Hs{vvʻ\02A(ve] x阂HUƏ-daa7c vOV.SYd1UǡO;ߛl4T=&*qSaa Z3qMr>{n-3ՠ sB,G.d @kmewvKbka,"KBqsO\̖߸]D;<3Y[#'y*>GΏf6YomJPGF "Dͷ+1>'^?w~^R 5>GxsWi;}m=V%=xB/Jy[rwă=#뢟}q? z| ?{O#?_߷/Kou]?rWԾPU&a;~>ڟf?{QhPu_v?isu{- /%>ń_||<_}H~_9 ?ϯ{oj+{?4 P7ޙo?:/~=_K_+>pt:M:iӬRmgu G_[OjuW|=U)׽W7Ǭ?n.ClTS,JH ɵE1XjjiihUXTSUT_w{WKu],ѴT2,TS {i7~o2[k#EhWdֱ )!V$H=Ľ2})6d_o}ո^kC|}vnvuhB.]tmg~>mfӔ9_oc%35k^yՖ;#ډ]VO5bGOeOZm_ig~Sܭ}:ˮkK/#@k_u򏹜w(s-Ņ_Y4+RE)zϊrowg7fܛ9Y̮s-qy JQ}]l#iU]Mo{.װ{O/IoYĵQȈRM@=wڽq ui[idjjydGw4Uh,ez{xo=.[n++2qޓ%C g}9O"|^sGkA"4oMNùp')7suח, IKdJ@{]Ux{:{^{{u׺{^^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^yrg`}[?YϺ#JӮ9;[ug7NޛS%QKjV Sa;'WBH+䥬G A>rüZM.Z4mRƒ!2\c?77뉢x;{: ӿ-M? *߸:vl$,|Pnz9iݬUa*q~"?t/Keݲ?mw#K V;9׉>$~wwwsVed' NbaD?)? _j/ma9OsMs={ޠG}9Jzݗb^cd/ĩן-pH;_S>)sKKO^ou^kONĽ3KOR?ISs-vu=m}z_?+V{)+h맢!aY5s vۧ$W6F)>q&V8=j Hwu]3^ w?_BjXۊwVϩgܔS7sܼ*9Ÿ^U}(gwەndX~oU|)C)^`),F~ [Gh*(z4^׽bOW&o|W=oBK%\{H‚?}O"yog_ݵN/]'OWFCCt`W^'z+:7:9ULYD;CT:݋RE3 Paoyo;3ګyx2hG :m&xq0-OqϽ Q5U{K-x,U6b# v91XcǼmwb'_ޛ.q׸%čuqIOD}Y=ݻX$oN"?Ă8݇ʇϯ{)o7jTT콳ژf+Ik+MO<1F=r(3'ޗ6O uCyOa&PqfF#w=OQWϖoޯo-l!f70Y311`.,^޸!{6vކF]UY:}ޕi7.6l~{[a>ܥ}mmb? f[U$VkZuO6i{ wqio?w V+׽OD-J)h%!XH,I POr܏o*|6A+u)# uC<o]I&?{_=b?j+iftb%Jn>ؖLܪq䅅m~m_ UiŸC}:=ŧq4Ec2 H,>ZuTvW \?l|J}cʙ#hWmXw&cs<%ED7&>0u4}H@o(歺vǓ-V!AD0G4_O+p>\=ee@I D*1RÈ={PW]vw-Wi{)Ow/Vv|Is歟۬ﺇ#JӮ3~H~Dw${$ܒwtI}7^E}5 eBF{ >vOV.?\5^N"7=s̴'o|̶VyU)u\C34Gi~jZ瓷8"ը?> -f>vm-oZԹGg]q_!ףg"]IAIOU[_o2tZ;ru$I$* -Ѷ=vcܶho-Df8 RH1i7lΪU%pP2M{'jhe8)yqPaYd` bl= $qFbPI$p$fGRI N{Џ]@u&}Tr~ 'IܔG5>s=9G4mNkna@i9z=.]ܐi[$x_˯{7ǝk~7Z $g1{Q며r$E5$Z\<\}=_7. ֖P KҀj5G$Py?_^rqss&&ϯ{3iQm7PNuL&a»F MxhϦ=GRgF?3i>Wʵ4>{E..0i=<^/O?ZGFzD4o[w??EyW-߇O׽~'ݕ \fN83.'vmSHԑVbr%&x{c.Fw_Q,mLxβ>eVH\A?Ky}Qo3<0ULt:?~u.TGl>W 񹧭ڸ}:qm8d"o6{卮u;=ͭ5+5ķ8xfJ7ep T|^Yؽ60=0AxUe8(H #Mu*}>G>#quoI5[iU41Yjr<ٶu[$BF%E yeF3N>ꜳ̞cZBop1p,|cIǕzVτm-=pZBIjّHib9U#S˭߻ nF~mnBۢLǂﹽZm>37;h_3ᖝڞ"<uc{N!o# f)Odj/ӛݿ`k>_IPIaɿ 6Xwj?q >{Sh:nśWq{Ky?e}~];{׽e/"܍G!oTZn=X׽ߺ^}Ə>+?>i+!v{[K׽{?_:kJ{GE>?iie[X[֟G8w\y:__Ni]W-?} lʕ)' nJ-Q55 %rǷ0nɏɈ _|Z?b7Ri%횟ճ׽ja{Q:{NA3vT` *ƞ60,OW]֊m1_#sV$נ5?cz|6?X4 ߽_ S++ɍlgV&*NB ?FI}q}P\БO޻Q(L>6hsFkwu?YXTO?#g6̿=Wq>>K_@·B`0{ycy|56?q4X{?u)&N%:UP=r9c`vw6$yդkGӤ &OCm>>r%ɼ[$ w)"ܥu0 LP{/=!rnEEƘcE&3?*y#u&ߛ~7.6?}Ymo-bS$2K:f鏶>{xMђREF),dej *+>m=dIۂYZ wAp*dgtG&I :'x=܏g}M 4NI Q@G }ASKj']A:*,ѡcRLi J59^Mqa"FW ac ظ.H5|C_ٞ=H^E uzNc{w,9ٛ1A]md:SK::f}xK7m}oZE")$v񫩥EUc_e0}Hpdyݕ|H#8|_w^ݔ[N+=RbaaiVi!wv߄A4{_yWcs]m.,bE5:j?NiԨeg}|NqVהwWR A!gicC#'{ aL W nׄ:̮V$TTlTQyje¿arϼsmY+Zcf4gڟp6M7[x|MN*'ԎYwV]-vn qT=G<ҌnVrl(Ѕ7rAQ\z{\0K,9z;gs9̡aӑ#'jĵPrA{߳ٯsJܹn;}D;:Mtqzwoo=m.k'ܖH]ud"U׽f/Իv}Fs)+51RMw6$~漓~'c˼MkaNQK 0P޳oܼySwhk d]%He8cj|Ma~MEYٲk 6y囩Ø6edFi!bQ߽Ox}/r}woiqImȦ;iҁ?(хa*YMoXع=̓V\Hca%F݉5W%N v(N'al}mnJݝ_x@ O+ikG>zbܵG?]mrvSb5Yϩie tm>줙A]FaO^_GuM+[+1Uguv̸ ۙ8^7AYs'G$Ƶ"NHQ//{jy x{}:K4CD-x6 wytJex [ݹ'人p"ۉO");S׽ߺ^wKwGw=;Q528̦㚾o:颫PQg/kݏۛnC{{KE_J5>rOۿ>OΜ յeG(JZq?΋L>` :>c!NMӑo+R̯"'={i-\mKKE,4 jgt[NFw7 86֎GUN\ t9î9i~>+6T1f(ueL崫'=LqOKEZ! $aٮ]ˑo97~sq5ʨgPBHfIc$k Rmr歕1\۱*1$P jTxvtefcᎺ($rݛ[_|=ߜva!n;}[xbp:so {?*{-*ʡxw"EI$b??.IA t}j"%4$n%) ZdjHeju@E)}h#v0Ʒ7+#Qg=h-9nXxSfJH*.AVP0{_e)X|n&/xZ AA+Ԙ3x%#w8`d37o!d.Sݴ8vRCE%`1+unsOv;:s7,ߋt&65U'QM "\|"Tʓ׽]/־c{ %һkuǾ$m}m<&)SNԘŬSMSU=U|UJXC%HӞ~rկ>s߹[ŲJspϥg G qFmAb roޟ;n`͊k]6/Ѹxʣ÷SRʫ$Z[wQ|)ۿwv+;o!)wce*1}-,qZSe+e<>>s.\>ۺN˧SDvQY ƵS<'ol[$PҲ۔:MBȍ”a׽۟w]vO{lͣ9r-2KQʈoQC2s_=oޗO:{3򷷷׻ Ԗ)8Khښє Y}ܽ^>yޭ!{ˉB2(x׽ޙVx*rXLio b/]Zj'I,.{}ayr$m{ gxƎV#asμ߸$.GFFH#N1~2tŝͲUջ766r_w6h L}>/xVKC쇻o܏Л -,Z4R;MBȄaBNCrٹl7GgG&F6UQ #{w|˶iZY2M R1VP8'Xgs?uݫE*WK5# p'Olu}C}tX*׺Zmtr6;[#{C%IiiݒC vOj 7^I[{z5͓9,x4*I{H R#̣]jcg CG).ta$`ƷRH6"EBAw'_c˭}}E[. ڽAVcvZ6+!=Om$}jyv'wdO򵸌5T,W֬:%]Dܽ{˖pw0m/hXo 0Wia'0Jѽs^[09?:kne?|サCݡ}Ú;SgV»! NWpxfaG-M^>gc uy;ޛmy/o߷Lm S\HXV x$q)D@O͟w/f-fY!7s=ԥ` H P/QGO7;ok=0g"jh]"xu41qǹ_'~s;]s%eԉҤB .ƺQ~N]pܝ"U`XUqG^R?P?/#yL-d6v6 r8'8瞑"wErx_iWޯk7G ݜt%'Tz "( @8wOq^o<715K4aK(${/||W0Kݻvh*0ݗ]y#Ncy)+~")e"ʷV֠{f.f/vCy;i2SՍ/i4o/jT-fJญtZ5{޿vV[˧_>7l5y0F2qG]E\#' 3;bI="v_wk;훕ϺWWa]7RR'(TXr޳Q6nlKnu[Ff ~bY$k׽3{Lcusm=WnmxS$UxX4U{9}oydu[ͻf;E^,jB1.y6NRKzhD3w"¹##-F7REm=[Qn'ΘÅ-5QlDᡚUl{rKr?f e/ 4z@W?VرsJsK(9GZթޔzwΜo5ܖ&.zt|:ҵ:ܻ弛먷'}{/3o3͛j?zY|R6 s7ܻfcn޿zKKW--(M3OYv|-+m~,uӭ )%/W{yŝh\?xbfcDl)iHcTAt(Q~l}YnB]ݦG`#{i-g'Y43M,KQ'Μr-].y [;I9P'!@JP׽'wߴ9ѷz;blkun;tSTr۟nQbTT#ah1w @Jj&H4Y0Y_/'.\Xm7\7q~2pNve攭dR(-Bt܉|} d쥎 $yX(5d0h2 hO{WhOh1;v7Qf{ʍ]ܕqѭdjlmRܪ 1EI PIB#*ɛඍDI5{ sYGV@{7?xv$/{ tew>R:Uu#RS1#I*c4b:ZuvgX!@M#˜ lSSZ6v$1#Ú7>v7SnO3TEHHֈB'={ʟʷn'Ǯ޳i7TEw^5ᡟpn/`'ᖚdYH_{_ɺR!b(h+Fn}>iOGjrV ~ +"+3 m?3~o~|c|܎ =W0V\ffh)i$jo[]gݣr܏r9o}wIVh!XVdehcDG+K@딯yf^~Tx)iZ')]#fMzQ* Tzw\{{u׺{^{{^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u^~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u~׽ߺ^~{߽u$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V lS  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v@#vw:V l7  t0[! [! [! [! [! [! %6,5L5T5` pyt0tT$$If!vh#v#v:V l7  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V l7  t0[! [! [! [! [! [! %6,5L52` pyt0tT$$If!vh#v#v:V l t0%655yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v#v:V lT t0%6555yt$$If!vh#v#v:V l\ t0%655yt$$If!vh#vd#v#v:V lT t0%65d55yt$$If!vh#vd#v#v:V lT t0%65d55yt$$If!vh#vd#v#v:V lT t0%65d55yt$$If!vh#vd#v#v:V lT t0%65d55yt$$If!vh#vd#v#v:V lT t0%65d55yt$$If!vh#vd#v#v:V lT t0%65d55yt$$If!vh#vd#v#v:V lT t0%65d55yt$$If<!vh#v":V lU t065"a<yt\p$$If<!vh#v#v :V l t0"655 / a<yt$$If<!vh#v#v :V l  t0"655 a<pyt$$If<!vh#v#v :V l% t0"655 a<yt$$If<!vh#v#v :V l% t0"655 a<yt$$If<!vh#v#v :V l] t0"655 a<yt$$If<!vh#v#v :V lZ t0"655 a<yt$$If<!vh#v#v :V lq t0"655 a<yt$$If<!vh#v#v :V lQ t0"655 / a<yt$$If<!vh#v#v :V l\ t0"655 / a<yt$$If<!vh#v#v :V l t0"655 / a<yt$$If<!vh#v#v :V l  t0"655 a<pyt$$If<!vh#v#v :V l@ t0"655 a<yt$$If<!vh#v#v :V lo t0"655 a<yt$$If<!vh#v#v :V lM t0"655 / a<yt$$If<!vh#v#v :V l  t0"655 a<pyt$$If<!vh#v#v :V lL t0"655 a<yt$$If<!vh#v#v :V lU t0"655 a<yt$$If<!vh#v#v :V l t0"655 a<yt$$If<!vh#v#v :V l t0"655 a<yt$$If<!vh#v#v :V l t0"655 a<ytDd D  3 @@"?w$$If!vh#v%:V lc t0%65%ytzDyK janet.duffy@wwl.nhs.ukyK <mailto:janet.duffy@wwl.nhs.ukDyK janet.duffy@wwl.nhs.ukyK <mailto:janet.duffy@wwl.nhs.uk$$IfH!vh#v#v=:V l t0655=aHyt$$IfH!vh#v#v=:V l t0655=aHyt$$IfH!vh#v#v=:V l t0655=aHyt$$IfH!vh#v#v=:V l t0655=aHyt$$IfH!vh#v#v=:V l t0655=aHyt$$IfH!vh#v#v=:V l t0655=aHyt$$IfH!vh#v#v=:V l t0655=aHytDyK InterpreterServices@wwl.nhs.ukyK Lmailto:InterpreterServices@wwl.nhs.ukDyK janet.duffy@wwl.nhs.ukyK <mailto:janet.duffy@wwl.nhs.ukDyK  Interpreter.Services@wwl.nhs.ukyK Nmailto:Interpreter.Services@wwl.nhs.uk^( 0h0002 0@P`p2( 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p 0@P`p8XV~_HmH nH sH tH @`@ \mNormalCJ_HaJmH sH tH R@R ct Heading 1dd@&[$\$5CJ0KH$\aJ0R@R ct Heading 5 <@&56CJ\]aJtH DA`D Default Paragraph FontVi@V  Table Normal :V 44 la (k (No List jj e Table Grid7:V04 @4 e0Footer  9r 6o6 K0 Footer CharCJaJ.)@!. e Page Number4@24 eHeader  9r 6U`A6  Hyperlink >*B*ph@oQ@ Ocooke_eCJOJQJ^JaJphBB@bB ct Body Text$a$5CJ\tH HCrH ctBody Text Indentx^HOH ctxl26dd[$\$5OJQJ\^JtH ^O^ ctxl348$dd%d'dOQ[$\$a$tH H@H ct Balloon TextCJOJQJ^JaJ$$ ctnormalB^@B ct0 Normal (Web)dd[$\$HH ctnormal immtextalign_left,, ct searchword*W`* ct`Strong5\.X`. ctEmphasis6]>Q@> ct Body Text 3!xCJaJ@@"@ ! List Paragraph "^f\@f $D0 z-Top of Form#$&dPa$<CJOJQJ^JaJToAT #D0z-Top of Form Char<CJOJQJ^JaJl]@l &D0z-Bottom of Form%$$dNa$<CJOJQJ^JaJZoaZ %D0z-Bottom of Form Char<CJOJQJ^JaJT`rT a' No Spacing'$CJOJPJQJ_HaJmH sH tH PK![Content_Types].xmlN0EH-J@%ǎǢ|ș$زULTB l,3;rØJB+$G]7O٭V$ !)O^rC$y@/yH*񄴽)޵߻UDb`}"qۋJחX^)I`nEp)liV[]1M<OP6r=zgbIguSebORD۫qu gZo~ٺlAplxpT0+[}`jzAV2Fi@qv֬5\|ʜ̭NleXdsjcs7f W+Ն7`g ȘJj|h(KD- dXiJ؇(x$( :;˹! I_TS 1?E??ZBΪmU/?~xY'y5g&΋/ɋ>GMGeD3Vq%'#q$8K)fw9:ĵ x}rxwr:\TZaG*y8IjbRc|XŻǿI u3KGnD1NIBs RuK>V.EL+M2#'fi ~V vl{u8zH *:(W☕ ~JTe\O*tHGHY}KNP*ݾ˦TѼ9/#A7qZ$*c?qUnwN%Oi4 =3N)cbJ uV4(Tn 7_?m-ٛ{UBwznʜ"Z xJZp; {/<P;,)''KQk5qpN8KGbe Sd̛\17 pa>SR! 3K4'+rzQ TTIIvt]Kc⫲K#v5+|D~O@%\w_nN[L9KqgVhn R!y+Un;*&/HrT >>\ t=.Tġ S; Z~!P9giCڧ!# B,;X=ۻ,I2UWV9$lk=Aj;{AP79|s*Y;̠[MCۿhf]o{oY=1kyVV5E8Vk+֜\80X4D)!!?*|fv u"xA@T_q64)kڬuV7 t '%;i9s9x,ڎ-45xd8?ǘd/Y|t &LILJ`& -Gt/PK! ѐ'theme/theme/_rels/themeManager.xml.relsM 0wooӺ&݈Э5 6?$Q ,.aic21h:qm@RN;d`o7gK(M&$R(.1r'JЊT8V"AȻHu}|$b{P8g/]QAsم(#L[PK-![Content_Types].xmlPK-!֧6 0_rels/.relsPK-!kytheme/theme/themeManager.xmlPK-!0C)theme/theme/theme1.xmlPK-! ѐ' theme/theme/_rels/themeManager.xml.relsPK] owy28L)quz[  ! Z p Y @ "  Md|A(*/!Yehj]L"c%&(|* +5,-W.012!45U7n9:E<?AAE(FIMNuPR0 ruvwxy   OQTVWXY]^'),OPQRSTUVWXYZ[\^_]`abcdefghijklmnowy28L)quz[  ! Z p Y @ "  Md|A(*/!Yehj]L"c%&(|* +5,-W.012!45U7n9:E<?AAE(FIMNuPRR  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXY0  d  T p 6I $'+- //W1133 56999:=>t@|BE0HIlOPTUWWXYZ[\]J]] ^f^^ _@___fh7s!w}Њj_Yؽ&lF:q]|370  !$'+-/135689<?ACDGJKMOQSTVXZ\^`bdefhjlnoqrsuvy{Qo8 X u E d * V # R a M o 66##,q./://033N589:== >)>B>a>u>>>W?Z???@@,@M@t@@AG:HIP!V#WWXYPYYY?ZZ\]:]Y]u]]]]]#^C^a^^^^^_,_H_d___Pchpu} (2Um4g]iVAxKs]{> 3Z0      "#%&()*,.0247:;=>@BEFHILNPRUWY[]_acgikmptwxz|@@X@[@MNNNNNyTTT0_XXX!!hAAARXX ,R$˜v.= 1 > @H 0(  OI(    '#' 3  "0? `  c $X99? '#'\   3 o"? J  #  "? h   C ' #" `? 'h   C ( #" `? (h   C * #" `? *h  C )#" `? )h  C +#" `? +h  C ,#" `? ,h  C -#" `? -VB @ C D"?VB  C D"?VB  C D"?VB  C D"?VB  C D"?!h  C .#" `?" .VB 0 C D"?VB 9 C D"?VB B C D"?p  :#  MC  S"?#t N s *X99? "`:#  O 6/4s4sO "`I]  /Z" PB S ZHcIf  Q 604s4sQ "`" )  0H R #    H S #   T 614s4sT "`d  1H U #   "  V 624s4sV "`(  2 W 634s4sW "`)  3 X 644s4sX "`-)  4 Y 654s4sY "`RA 5H ZB #  H [ #  H \ #  - ] 664s4s] "`Q 6 ^ 674s4s^ "`WR  7H _B #  hAiH ` #  iWjXH a #  hiWbz   $ C  3"?t  s *X99? "`  $  6!;Ν;Ν "`  !  6";Ν;Ν "` h= "  6#;Ν;Ν "`   #H  #  ( ) H  #    6$;Ν;Ν "`h" $  6%;Ν;Ν "`" %ZB B S D @ A ZB  S D h  6&;Ν;Ν "`N  &ZB  S D hZB  S D P=Q ZB  S D ZB  S D WX  #2 C  S"?t  s *X99? "` #2  6;Ν;Ν "`S }    6;Ν;Ν "`S    6;Ν;Ν "`j   0;Ν;Ν"`   0;Ν;Ν"`! B   ' ( B B  } S B   hiB B  h  0;Ν;Ν"`S  B B  j  0;Ν;Ν"`o B   B B   o  0 ;Ν;Ν"`  B   TB  C DTB  C D?@  0;Ν;Ν#" `? VB  C D"?VB  C D"?  0;Ν;Ν#" `?   0;Ν;Ν#" `? VB @ C D"?   0;Ν;Ν#" `?  VB  C D"?   6;Ν;Ν #" `?  D   "?VB " C D"? K 5# %C  S"?$t & s *X99? "`K 5# ' 684s4s' "`I ^  8Z" (B S ZH`[`I 6   ) 694s4s) "`IS] p 9H * #    H + #   , 6:4s4s, "`S   :H -B #   SP" O  ;"?% ;P" P  <"?& <P" Q  ="?' =P" R  >"?( >P" S  ?"?) ?P" T  @"?* @P" U  A"?+ AP" V  B"?, BP" W  C"?- CP" X  D"?. DP" Y  E"?/ EP" Z  F"?0 FP" [  G"?1 GP" \  H"?2 HP" ]  K"?5 KP" ^  I"?3 IP" _  J"?4 JP" `  L"?6 LP" a  M"?7 MP" b  N"?8 NP" c  O"?9 OP" d  P"?: PP" e  Q"?; QP" f  R"?< RP" g  S"?= SP" h  T"?> TP" i  U"?? UP" j  V"?@ VP" k  W"?A WP" l  X"?B XP" m  Y"?C YP" n  Z"?D Z z  "% pC  3"?t q s *X99? "` "% r 6/./.r "`Dnj H t #  jk u 6/./.u "`   v 6/./.v "`T e   w 6/./.w "` Rk  x 0/./.x"`\  y 0/./.y"`] B }  B ~   T B B    B   B B  k\B   ]B   $%B B  j2 z  "# C  3"?t  s *X99? "` "#  6/./. "`Dnj   6/./. "`bD H  #  jk  6/./. "`    6/./. "`, -h    6/./. "`S   0/./."`0P   0/./."` 0   0 /./."`i"    0 /./."`G    0 /./."`w!  B   B   B     B B  U B   PQB   Q B   $%TB  C DF  0 /./."`   TB B C DGTB  C DB B  j  0 /./."`Gi"f  TB B C D$$V B  #" N?S|  S 2A CMYK BLUE3"`?B S  ?OPOORSOQUQVZWV[ XW\ Y]_ ^^` ]^a '(''*+')-rrt}~xx !"#r$%&'()*+,-! ''1111111111112@@ @"@#@&@'@(@)@-@.@0@2@;@>@Y@^@a@LOUU'UEUOUvUUUU VVV'V.VAVSVfV{VVVVVVVV W'W2WkWWWW0M'l@ 4&;t:%2t p)5%)t  tnt  ntZtZ tyt  -t$ & thlte$$5tl&t typ&t@ Ud!it9tBEEHt0U4U4t SvtNrt }tGt@ NC t" \ wtCt}/tFj t  t("Lt#t  otRtMD%/t@ %>&st@OC & tPC&}tQC&tRR+&stSr%DtT %tUR+&ptVK&tW& tX&tYpI&tZpI&ct[u't\Q&nt^9&}t_a>:&t]%"t`%ta%Atba:&L tca:& tdpI&tepI&tfpI&tgp0I&thpI&b ti&tj&9!tk&1tla:&i tm& tn& tS S S S S S S S 0 /q/3aAJ1D )//3uA^1>*urn:schemas-microsoft-com:office:smarttags PersonName  !!a+j+vvvvxxׯدگۯݯޯu}6?.1!!x%~%336ׯدu}-.1333YY||~~PPدگۯݯޯu}.1YY||~~PPددگۯۯݯޯ!"#,;?NYjjksmn_`fgZ[ѴҴ&'ɸ6677F &'KL>?^_ <=^_Z[fg-.1/Mg&pz XuP# w/{,*$9:1X4xy &2&&[&@|f"Vd'2+)@(&3(7$a*gj*-W.m0r1r9*2q,5plZ